Labshake search
Citations for Illumina :
1351 - 1400 of 1756 citations for Acetamide N 5 bis 2 hydroxyethyl amino 2 2 chloro 4 6 dinitrophenyl azo 4 methoxyphenyl since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were pelleted (500xg, 10 min, 4 °C) and tagmented with the Nextera DNA Library Prep Kit (Illumina, FC-121-1030) for 1 h at 37 °C ...
-
bioRxiv - Zoology 2020Quote: ... or 70 bp (Exp#4) RNA sequencing (RNAseq) was performed on Illumina HiSeq 2000 platform (Illumina, Inc., San Diego, CA, USA) from libraries construed as has been described in previous report (Zhang et al. ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-10 ng of the full-length cDNA was used as input for preparing Nextera XT (Illumina, cat. # FC-131-1024) libraries following the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene V3-V4 regions were amplified (4) followed by addition of Illumina sequencing barcoded adaptors (Illumina, CA, USA.). The libraries were normalized and pooled for multiplex sequencing using the Illumina MiSeq v3 600 cycles cartridge (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... pre-treatment and post-treatment/acquired resistant biopsies were obtained from patients receiving various immune checkpoint inhibitor treatments (PD-L1, PD-1, CTLA-4 targeted therapies) for RNA-seq analysis (Illumina HiSeq2500) from formalin fix paraffin embedded samples ...
-
bioRxiv - Genomics 2023Quote: ... A total of 4 µg of RNA per sample was subjected to rRNA depletion using the RiboZero Plant Leaf kit (Illumina, MRZPL1224) following the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Total RNA input ranging from 64.4 ng – 1000 ng was used to initiate the Illumina Stranded Total RNA Prep Ligation with Ribo-Zero Plus (Illumina 20040525) library preparation ...
-
bioRxiv - Immunology 2024Quote: ... One library consisting of a total of 4 samples were pooled and sequenced on the NextSeq 2000 (Illumina, San Diego, CA) using a P3 100 cycle kit (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... and feature barcoding libraries were pooled at a 4:1:1 ratio and treated with Illumina Free Adapter Blocking Reagent (Illumina, #20024144). Sequencing of pooled libraries was carried out on a NextSeq 2000 sequencer (Illumina) ...
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Biochemistry 2024Quote: ... Ten representative strains from each 95% ANI clade were selected for long-read Nanopore sequencing (Oxford) and compiled with public SRA data from previously sequenced strains (N=12 Illumina, N=3 PACBIO). Data were combined for each strain to perform a hybrid assembly with unicycler69 using a kmer count 31,41,51,61,71,81,91,95,101,105,111 and “mode” determined by ANI similarity to a reference strain (i.e. ...
-
bioRxiv - Genetics 2021Quote: ... Individual libraries were pooled in equimolar ratio (4 nM for each) and sequenced with the Nextseq 550 platform (Illumina, San Diego, California) in a single end 75 cycles high output run ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were diluted from 26.2 nM (HBA1) and 33.4 nM (HBA2) to a concentration of 4 nM and pooled for sequencing on a MiSeq (Illumina, San Diego, CA).
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were diluted to a final concentration of 4 nM and sequenced with the NextSeq 500/550 HighOutput Kit v2.5 (75 cycles, Illumina, cat. no. 20024906), with 75 bp reads and pair-end sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Neuroscience 2021Quote: ... We used TruSeq Stranded mRNA kits (Illumina P/N 20020594) to prepare the stranded mRNA libraries ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.4 μg total RNA was used for RNA-seq library construction by a TruSeq RNA Library Prep Kit V2 (Illumina, RS-122-2001). Both ChIP-seq and RNA-seq libraries were sequenced at the Bauer Core Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... and centrifuged at 500 g at 4° C to isolate nuclear pellets that were treated in 50 μL reactions with Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 min at 37° C ...
-
bioRxiv - Genomics 2021Quote: ... The PCR products (4 nM from every single cell) were treated with the Miseq Reagent Kit v2 50 Cycles (Illumina KK, Tokyo, Japan) and sequenced by the MiSeq sequencer (26 bp ...
-
bioRxiv - Microbiology 2021Quote: ... The PCR products (4 nM from every sample) were treated with the MiSeq Reagent Kit v2 (50 cycle format; Illumina KK, Tokyo, Japan) and sequenced using the MiSeq Sequencer (26 bp ...
-
bioRxiv - Microbiology 2022Quote: ... for amplicon sequencing of the V3-4 hypervariable region of the 16S rRNA gene (position 341-806) on a MiSeq desktop sequencing platform (Illumina, San Diego, CA) operated under paired-end mode ...
-
bioRxiv - Microbiology 2022Quote: ... for amplicon sequencing of the V3-4 hypervariable region of the 16S rRNA gene (position 341-806) on a MiSeq desktop sequencing platform (Illumina, San Diego, CA) operated under paired-end mode ...
-
bioRxiv - Genetics 2023Quote: ... and 4 μl of bisulfite-converted DNA was measured on the Illumina HumanMethylation450 array using the manufacturer’s protocol (Illumina, San Diego, CA, USA). Preprocessing and normalization of the data were done using DNAmArray workflow previously developed by our group (https://molepi.github.io/DNAmArray_workflow/) ...
-
bioRxiv - Genomics 2023Quote: ... 4 μl of 1 ng amplicon DNA was combined with a mix containing 1 μl of Amplicon Tagment Mix (Illumina, FC- 131-1096) and 5 μl of Tagment DNA Buffer (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... 4 μg total RNA was used to prepare RNA-seq libraries using the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, US). Strand specific paired-end mRNA sequencing was performed on DNBSEQ platform at the Next-Generation Sequencing Core of the BGI Genomics Service (Hong Kong ...
-
bioRxiv - Plant Biology 2024Quote: ... A Qubit 2.0 Fluorometer was used to calculate RNA concentration and 4 mg of total RNA was used to prepare libraries with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, US). Single-end sequencing (50bp ...
-
bioRxiv - Microbiology 2021Quote: ... Samples were pooled for RNAsequencing of 4 nM of total cDNA and sequencing was performed using a NextSeq 500 Instrument (Illumina Inc San Diego, CA).
-
bioRxiv - Cell Biology 2024Quote: ... Nuclei were pelleted by centrifugation at 2500g for 10 min at 4°C and resuspended in 25 µL of 2x TD Buffer (Illumina Cat #FC-121-1030), containing 8 µL of Tn5 Transposes (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Developmental Biology 2022Quote: ... PhiX Control v3 adapter-ligated library (Illumina p/n FC110-3001) was spiked-in at 1% by weight to ensure balanced diversity and to monitor clustering and sequencing performance ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Plant Biology 2021Quote: ... were randomly pooled (4 samples per pool) and grouped using the TruSeq Paired-End Reads Cluster Kit on the cBot platform (Illumina Inc., San Diego, CA, USA). The cDNA libraries were posteriorly sequenced on the Illumina Genome platform Analyzer IIx with a TruSeq kit with 36 cycles (Illumina ...
-
bioRxiv - Systems Biology 2024Quote: ... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
bioRxiv - Neuroscience 2020Quote: ... and hybridized to MouseWG-6 v2.0 Expression BeadChips (Illumina). Raw data were preprocessed with quantile normalization in R/Bioconductor using the package beadarray ...
-
bioRxiv - Neuroscience 2020Quote: ... The TruSeq RNA Sample Preparation Kit (Illumina, Cat. N°RS-122-2002, USA) was used for library preparation (1 µg total RNA) ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=84 genotyped animals retained after quality control of the Illumina reads). Controls were animals which were lesion and culture negative for M ...
-
bioRxiv - Genetics 2020Quote: ... bovis (n=128 genotyped animals retained after quality control of the Illumina reads). An additional Fulani animal was also genotyped but we did not have any information on its M ...
-
bioRxiv - Genetics 2020Quote: ... and the libraries were sequenced in pools of 6 (Illumina HiSeq2500 high output flow-cell ...
-
bioRxiv - Cancer Biology 2024Quote: ... using IDT for Illumina RNA UD Indexes (Illumina: 20040553-6). Library quantification and assessment was done using a Qubit FLEX fluorometer and an Agilent TapeStation 4150/Fragment Analyzer 5300 ...
-
bioRxiv - Cell Biology 2024Quote: ... using IDT for Illumina RNA UD Indexes (Illumina: 20040553-6). Library quantification and assessment was done using a Qubit FLEX fluorometer and an Agilent TapeStation 4150/Fragment Analyzer 5300 ...
-
bioRxiv - Genetics 2022Quote: ... Common bi-allelic SNP genotyping was performed using Illumina Global Screening Array SNP-microarray technology (Illumina, San Diego, California, USA). Genotype assignment from the microarray fluorescence data was performed using Illumina’s Genome Studio software.
-
bioRxiv - Genomics 2022Quote: ... the ScriptSeq™ Index PCR Primers (Sets 1 to 4) and the FailSafe™ PCR enzyme system (all sourced from Epicentre®/Illumina® Inc., Madison, WI, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2024Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.