Labshake search
Citations for Illumina :
1301 - 1350 of 1467 citations for En 1948 4 Marker Pcb Extraction Spike 13C12 99% 100 Ng Ml In Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Sequencing was performed to generate 100 bp (or 150 bp) paired-end reads on a HiSeq 2000 (or 2500) platform (Illumina) according to the manufacturer’s standard protocols ...
-
bioRxiv - Genomics 2019Quote: ... Hand > MblRNAi;HA-UPRT and Hand > Bru3;HA-UPRT RNA fractions were mixed at equal concentrations and sequenced (100-bp paired-end reads) on the same lane of a HiSeq 2000 (EMBL Gene Core Illumina Sequencing facility ...
-
bioRxiv - Immunology 2020Quote: ... and sequenced across 75 or 100 bp using a paired-end strategy on a NextSeq 550 or a HiSeq4000 (Illumina). One or two biological replicates were sequenced per experiment.
-
bioRxiv - Systems Biology 2019Quote: ... The resulting directional RNA-seq libraries were sequenced using single-end 100-nt read chemistry on an Illumina HiSeq 2500 platform (Illumina) at the Lausanne Genomic Technologies Facility.
-
bioRxiv - Systems Biology 2021Quote: ... The resulting pools were loaded into NovaSeq Reagent cartridges for 100-cycle single-read analysis and sequenced with a NovaSeq6000 following the manufacturer’s recommended protocol (Illumina Inc.).
-
bioRxiv - Cancer Biology 2021Quote: ... The resulting pool was loaded into 200cycle NovaSeq Reagent cartridge for 2×100 sequencing and sequenced on a NovaSeq6000 following the manufacturer’s recommended protocol (Illumina Inc.).
-
bioRxiv - Immunology 2020Quote: ... Indexed samples were pooled together for 100 cycles of paired end sequencing on a HiSeq 4000 or HiSeq 2500 system (Illumina). More than 40 million reads per sample were sequenced for downstream analysis.
-
bioRxiv - Genomics 2021Quote: ... The final libraries containing barcoded single-cell transcriptomes were sequenced at 100 cycles using the S2 flowcell on the Novoseq 6000 system (Illumina).
-
bioRxiv - Immunology 2022Quote: ... The libraries were sequenced for 50 or 100 cycles (paired-end read) with a HiSeq 3000 or NovaSeq 6000 (Illumina).
-
bioRxiv - Genomics 2022Quote: ... Samples were sequenced with a coverage of 50 M paired end reads (2 x 100 bp) /sample on a NovaSeq (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... Isolated RNA was chemically degraded into fragments of approximately 100 nucleotides in length using fragmentation buffer (Illumina, Inc., CA, USA). A Magna MeRIP™ m1A Kit (Merck Millipore ...
-
bioRxiv - Neuroscience 2022Quote: ... The indexed libraries were then subjected to paired-end (2×100 bp) sequencing on the Illumina NovaSeq platform (Illumina, Inc.) by Macrogen Incorporated.
-
bioRxiv - Developmental Biology 2022Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on an Illumina NovaSeq 6000 sequencer at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was performed in paired-end mode with a S1 and S2 flow cell (100 cycles) using NovaSeq 6000 sequencer (Illumina) at NCCT ...
-
bioRxiv - Cell Biology 2022Quote: ... A library of 350-800 bp length was run on a NovaSeq 6000 using NovaSeq 6000 SP Reagent Kit 100 cycles (ref #20027464, Illumina) with 17*-8-105* cycles reads.
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were multiplexed and sequenced using P2 and P3 (100 Cycles) reagents on a NextSeq 2000 device (Illumina, Table 1S). Sequencing data was demultiplexed and converted to FASTQ format using bcl2fastq2 v2.20 (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on Illumina HiSeq2500 sequencers located at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Immunology 2024Quote: ... The sequencing was performed on an Illumina NovaSeq using S1 and S2 100 cycle kits (Illumina, San Diego, CA, USA) with specific dimensions (67 × 8 × 50 bp).
-
bioRxiv - Microbiology 2024Quote: ... Paired-end (100 bp) sequencing of each RNA library was performed on a HiSeq 2500 sequencing platform (Illumina, CA, USA).
-
bioRxiv - Cell Biology 2023Quote: ... 0.8 µl 100 µM barcoded CRISPR KO primer (oMCB1440, aatgatacggcgaccaccgagatctacacGATCGGAAGAGCACAC GTCTGAACTCCAGTCAC NNNNNN CGACTCGGTGCCACTTTTTC, where NNNNNN is an Illumina TruSeq index), and 69.4 µl nuclease-free water were added to the 5 µl PCR1 reaction ...
-
bioRxiv - Developmental Biology 2023Quote: ... Barcoded cDNA libraries were multiplexed onto a TruSeq paired-end flow cell and sequenced (100-bp paired-end reads) with a TruSeq 200-cycle SBS kit (Illumina). Samples were run on an Illumina NovaSeq 6000 sequencer at the KUMC Genome Sequencing Facility ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was performed to generate paired-end reads (2 × 100 bp) with a 200-cycle S1 flow cell on a NovaSeq 6000 sequencing system (Illumina).
-
bioRxiv - Cancer Biology 2022Quote: ... The resulting pool was loaded into the appropriate NovaSeq Reagent cartridge for 100-cycle paired-end sequencing and run on a NovaSeq6000 following the manufacturer’s recommended protocol (Illumina Inc.). Sequencing quality control was assessed using FASTQC v0.11.5 (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Immunology 2022Quote: ... All Fast-ATAC libraries were sequenced using a 2×100 bp paired-end protocol on the HiSeq 4000 Sequencing System (Illumina).
-
bioRxiv - Genomics 2023Quote: ... The CUT&Tag libraries were subjected to 50bp paired end sequencing on a NextSeq 2000 platform using a P2 100-cycle kit (Illumina). Antibodies are listed in Key Resources Table.
-
bioRxiv - Cancer Biology 2023Quote: ... The resulting cDNA library was sequenced on an Illumina NovaSeq 6000 using the S1 100 cycle Reagent Kit v1.5 (Illumina 200228319), with a targeted read depth of 20,000 reads/cell.
-
bioRxiv - Neuroscience 2023Quote: ... The uniquely barcoded libraries were multiplexed onto one lane and 100-bp paired-end deep sequencing was carried out at the HiSeq 4000 (Illumina) generating ∼20 million reads per sample.
-
bioRxiv - Molecular Biology 2023Quote: ... we used one lane of a NovaSeq 6000 SP Reagent Kit v1.5 (100 cycles) (Illumina, San Diego, CA, USA, 20028401) (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... and values ≥7.5 were used for library preparation and paired-end (2 × 100 bp) RNA-sequencing on an Illumina NextSeq 6000 instrument (Illumina). Libraries were prepared using a Kapa RNA HyperPrep kit with ribosomal reduction ...
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycle sequencing kit (v1.5) to a minimum depth of 50K reads per cell (Illumina Inc., San Diego, CA, USA). Base calling was done by Illumina RTA3 and output was demultiplexed and converted to FastQ format with Cell Ranger (10X Genomics ...
-
bioRxiv - Bioengineering 2023Quote: ... Pools were sequenced with 100 cycle run kits (28bp Read1, 8bp Index1 and 91bp Read2) on the NovaSeq 6000 Sequencing System (Illumina). Cell Ranger Single Cell Software was used to perform de-multiplexing ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were then pooled and sequenced at The Jackson Laboratory using a 100 bp paired-end process on a HiSeq 2500 (Illumina) sequencing system (RRID:SCR_016383 ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled libraries were loaded onto a NovaSeq 6000 sequencer at 300 pM final concentration for 100 bp paired-end sequencing (Illumina). Approximately 40 million reads per library was generated ...
-
bioRxiv - Microbiology 2023Quote: ... and RNA sequencing to a depth of 10 million 75 bp or 100 bp single end reads using a Nextseq500 or NextSeq2000 sequencing system (Illumina). Data were analysed using CLC Genomics Workbench version 21.0.5 (Qiagen) ...
-
bioRxiv - Neuroscience 2023Quote: ... and were subsequently sequenced at paired-end 150 bp (DNA libraries) and paired-end 100 bp (RNA derived libraries) on a NovaSeq X Plus (Illumina) platform.
-
bioRxiv - Cancer Biology 2023Quote: ... The 100-cycle paired end sequencing run was performed using a NovaSeq 6000 S1 Reagent Kit v1.5 200 cycle (Illumina 20028318). Sequence data was converted to fastq files ...
-
bioRxiv - Immunology 2023Quote: ... 8 cycles for i7 index and 61 cycles for read 2) with Novaseq S2 flow cells (100 cycles) using Novaseq 6000 sequencer (Illumina) in the Life and Brain Center ...
-
bioRxiv - Cancer Biology 2023Quote: We generated RNA-seq data from the H1299 non-small cell lung cancer cell line with 108,321,106 reads (TrueSeq RNA v2 100 bp paired-end library and Illumina HiSeq2500 machine from Illumina, CA, USA). rTea was run on the RNA-seq data ...
-
bioRxiv - Cancer Biology 2023Quote: ... Equimolar multiplexed libraries were then sequenced using 100 or 150 bp paired-end runs on HiSeq 4000 or NovaSeq 6000 S4 platforms (Illumina) at the DKFZ Genomics and Proteomics Core Facility ...
-
bioRxiv - Genomics 2024Quote: ... and reduced representation libraries were sequenced using single-end reads with a NextSeq 2000 P2 reagent kit (100 Cycles; Illumina).
-
bioRxiv - Cell Biology 2024Quote: ... Indexed libraries were pooled equimolar and sequenced on a NovaSeq 6000 in a PE28/88 run using the NovaSeq 6000 SP Reagent Kit (100 cycles) (Illumina). FASTQ files from sequencing (NovaSeq ...
-
bioRxiv - Cancer Biology 2024Quote: ... and the 10x Genomics recommended sequencing parameters were used to run on the NovaSeq 6000 with S4 PE 100 kits (Illumina).
-
bioRxiv - Genomics 2024Quote: ... The pooled RNA-seq libraries were subjected to two rounds of 50 bp paired end sequencing on a NextSeq 550 platform using a P2 100-cycle kit (Illumina).
-
bioRxiv - Genomics 2024Quote: ... Sequencing was performed using the massively parallel sequencing on the Novaseq 6000 platform using Novaseq S4 PE 100 kits (Illumina) to capture the expression of ∼200-5,000 genes/nuclei.
-
bioRxiv - Cancer Biology 2024Quote: ... The gDNA was amplified according to Broad Genome Perturbation Portal protocols and single end 100 cycle sequencing was performed on a NovaSeq 6000 (Illumina) by the Hartwell Center for Genome Sequencing Facility at St ...
-
bioRxiv - Plant Biology 2024Quote: ... Sequencing of the RNA-Seq library was carried out to produce paired-end reads (2 × 100 bp) using the Illumina Novaseq system (Illumina), with sequencing services provided by Macrogen ...
-
bioRxiv - Neuroscience 2024Quote: ... was performed at 21 to 41 million reads/sample in single-end mode with 100 nt read length on the NextSeq 2000 platform (Illumina). Demultiplexed FASTQ files were generated with bcl2fastq2 v2.20.0.422 or bcl-convert v4.0.3 (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... using 28 + 91 -bp paired-end reads and 8-bp Index 1 reads with a 100-cycle kit (Illumina, 20028400).
-
bioRxiv - Molecular Biology 2024Quote: ... and values ≥7.5 were used for library preparation and paired-end (2 × 100 bp) RNA-sequencing on an Illumina NextSeq 6000 instrument (Illumina). Libraries were prepared using a Kapa RNA HyperPrep kit with ribosomal reduction ...
-
bioRxiv - Cell Biology 2024Quote: ... Libraries were sequenced to a median depth of 35-40 million 100-bp single-end reads on a HiSeq sequencer (Illumina). The FASTQ files underwent quality control metrics (trimming) ...