Labshake search
Citations for Illumina :
1251 - 1300 of 1557 citations for 7 Oxabicyclo 2.2.1 hept 5 ene 2 carboxylicacid 2 hydroxy 1R 2R 4R rel 9CI since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Libraries were enriched for these loci using the MyBaits protocol (Arbor Biosciences, Ann Arbor, MI, USA) and sequenced on an Illumina MiSeq (2 x 300 cycles, v3 chemistry; Illumina, Inc., San Diego, California, USA). Raw reads have been deposited at the NCBI Sequence Read Archive (BioProject PRJNA544074 ...
-
bioRxiv - Immunology 2021Quote: ... Paired end (2×300 cycle) sequencing was performed on a Miseq® sequencer using a 600 cycle v3 Reagent Kit (Illumina Inc., San Diego CA) producing 300 base paired end reads.
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were run in the rapid run flow cell and were paired-end sequenced (2×76bp) on HiSeq 1500 (Illumina, San Diego, CA 92122 USA).
-
bioRxiv - Cancer Biology 2022Quote: ... Libraries were run in the Rapid Run flow cell and paired-end sequenced (2×76 bp) with the HiSeq 1500 (Illumina, San Diego, CA 92122 USA).
-
bioRxiv - Microbiology 2022Quote: ... The latter was quantified by real-time quantitative reverse transcriptase-polymerase chain reaction and then sequenced on a Illumina MiSeq system with 2 × 250bp paired-end reads (Illumina Inc., San Diego, CA, USA) at the GeT-PlaGe Platform (Toulouse ...
-
bioRxiv - Plant Biology 2022Quote: ... japonica essentially as described previously (Padmarasu et al., 2019), and were sequenced (v1.5 chemistry, paired-end, 2 x 111 cycles) using the NovaSeq6000 device from Illumina (Illumina Inc., San Diego, CA, USA) at IPK Gatersleben.
-
bioRxiv - Cancer Biology 2023Quote: ... The libraries were run in the rapid run flow cell and were paired end sequenced (2×76bp) on HiSeq 1500 (Illumina, San Diego, CA 92122 USA).
-
bioRxiv - Microbiology 2023Quote: Illumina sequencing was performed at the Lausanne Genomic Technologies Facility (GTF) of the Lausanne University using an Illumina MiSeq instrument in paired-end mode 2 × 250 nt (Illumina, San Diego, CA, United Sates).
-
bioRxiv - Microbiology 2023Quote: ... The 16S rRNA gene libraries were then sequenced on a NovaSeq 6000 instrument with a SP flow cell (2 × 250 bp) (Illumina Inc., San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... The tissue-derived Illumina libraries were sequenced using a 2 x 250 cycle MiSeq Reagent Kit v2 on a MiSeq platform (Illumina Inc., San Diego, CA, USA). The 16S rRNA gene V4-V5 region was amplified from each water sample and sequenced using the Illumina MiSeq platform (Illumina Inc. ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with a 2×250bp paired-end configuration on an Illumina MiSeq platform applying the MiSeq v2 500-cycle sequencing kit (Illumina Inc., San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 600 nL of tagmentation reaction mix containing Tagmentation DNA buffer (TD) and Amplicon Tagment Mix (ATM) at 2:1 v/v ratio (Nextera kit, Illumina, cat. no. FC-131-1096) into each well and performed tagmentation at 55° C for 5 min followed by hold at 4° C in a PCR thermocycler ...
-
bioRxiv - Physiology 2021Quote: ... 3’ and 5’ adaptors (Illumina) were ligated and the resulting product was reverse transcribed to generate cDNA by PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 5) DC3000 + C (Illumina only), 6 ...
-
bioRxiv - Immunology 2022Quote: ... and 5 µl Tn5 (Illumina) in nuclease-free water or in 50 µl tagmentation mix “Corces et al ...
-
bioRxiv - Developmental Biology 2020Quote: ... 5 ul TDE1 (Illumina 20034197)) and shaken at 1000 RPM for 30 minutes at 37°C ...
-
bioRxiv - Genetics 2022Quote: ... the genome FASTA file was augmented with ERCC sequences to create a STAR genome index with 99 bp overhangs (optimized for Illumina 2 × 100 bp paired-end reads). Two-pass mapping was executed ...
-
bioRxiv - Microbiology 2024Quote: ... V3–V4 region of the 16S rRNA gene were amplified using the primer set 341F– 785R (Klindworth et al. 2013) and sequenced using Illumina MiSeq 2 x 300 bp (Illumina Inc., San Diego, CA, United States). Demultiplexed and adapter clipped reads obtained from LGC Genomics were processed as mixed ones ...
-
bioRxiv - Microbiology 2023Quote: ... and short read sequencing using the Illumina platform (Illumina DNA Prep kit and IDT 10bp UDI indices, and sequenced on an Illumina NextSeq 2000 producing 2×151bp reads) was performed by the Microbial Genome Sequencing Center ...
-
bioRxiv - Genomics 2019Quote: ... Bead-bound Hi-C DNA was amplified with 7 PCR amplification cycles using PE PCR 1.0 and PE PCR 2.0 primers (Illumina). After PCR amplification ...
-
bioRxiv - Biochemistry 2024Quote: Forward Illumina Adapter: 5’-ACACTCTTTCCCTACACGACGCTCTTCCGATCTXXXX-3’ Reverse Illumina Adapter: 5’-GACTGGAGTTCAGACGTGTGCTCTTCCGATCTXXXX-3’ Next generation (Illumina) sequencing was performed by Azenta (Amplicon-EZ) ...
-
bioRxiv - Immunology 2019Quote: ... The fragmented mRNA samples were subjected to cDNA synthesis using Illumina TruSeq® RNA sample preparation kit version 2 (Illumina, #RS-122-2001 and #RS-122-2002) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2023Quote: ... The library preparation for bulk tumors and cell lines was generated using the TruSeq Stranded mRNA sample preparation kit (Illumina Inc., San Diego, RS-122-2101/2) according to the manufacturer’s instructions (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced to an average depth of 7 gbp per fraction on the Illumina NovaSeq (Illumina, San Diego, CA).
-
bioRxiv - Microbiology 2021Quote: ... The amplicon library was diluted to 7 pM containing 20 % PhiX before sequencing on the MiSeq platform (Illumina, USA) using MiSeq reagent v3 kit to generate 300 bp paired-end reads ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced on the iSeq (cases 1 - 6 and controls) or NovaSeq 6000 (case 7 and controls) (Illumina) using 150nt paired-end reads.
-
bioRxiv - Genetics 2022Quote: ... The flow cell was loaded with 5 picomolar pooled libraries containing 5% PhiX control V3 (Illumina). Raw sequencing data were demultiplexed with Bcl2Fastq software (v2.19 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Each well contained 10 μL tagmentation buffer (5 μL NIB and 5 μL TD buffer from Illumina). For the second sort plate ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... Samples with an RNA-integrity number of more than 7 were subjected to library preparation and sequencing to 151 paired-end cycles on the NovaSeq-6000 platform (Illumina), resulting in approximately 35 million reads/sample ...
-
bioRxiv - Plant Biology 2021Quote: ... Samples with a RIN value of > 7 were used for library preparation (Illumina TruSeq Stranded Total RNA kit, Illumina, USA) and sequenced on an Illumina HiSeq 4000 to obtain 150bp paired-end reads ...
-
bioRxiv - Genetics 2022Quote: ... Extracted RNA with RNA integrity number (RIN) ≥7 was used as input for the TruSeq Stranded mRNA HT Sample Prep Kit (Illumina) according to the manufacturer ‘s recommendations ...
-
bioRxiv - Genomics 2021Quote: ... [140] with parameters “2 7 7 80 10 100 2000 -ngs -h”. We also used kseek to search for tandem repeats in the male Illumina reads.
-
bioRxiv - Cell Biology 2020Quote: ... denatured and diluted to 10 pM with pre-chilled hybridization buffer and loaded into TruSeq PE v3 flowcells on an Illumina cBot followed by indexed paired-end sequencing (101 + 7 + 101 bp) on an Illumina HiSeq 2000 using TruSeq SBS Kit v3 chemistry (Illumina). Paired de-multiplexed fastq files were generated using CASAVA software (Illumina ...
-
Ribonuclease Inhibitor and Angiogenin collaboratively regulate cell-type-specific global translationbioRxiv - Biochemistry 2024Quote: ... between 200 ng to 1μg of high-quality RNA (RIN > 7) samples were used for cDNA synthesis and library preparation using the TruSeq Stranded total RNA Sample Preparation kit (Illumina). The cDNA libraries were then sequenced with 2 × 150 bp reads on an Illumina HiSeq3000 instrument ...
-
bioRxiv - Biophysics 2021Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Immunology 2020Quote: ... 5 μl Nextera i5 primer (S5xx, Illumina), and 5 μl of a custom i7 primer mix (0.5 μM i7_BCx + 10 μM i7_primer ...
-
bioRxiv - Biophysics 2022Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples ...
-
bioRxiv - Biophysics 2023Quote: ... The forward primer (5’ P5 Illumina adapter) was the same for all samples (GJJ_1J) ...
-
bioRxiv - Cancer Biology 2023Quote: With the exception for Whole Transcriptome Amplification Analysis (WTA)7 (sent to Novogene and sequenced on a S4 flowcell of an Illumina Novaseq), all single-cell or bulk sequencing was prepared as ready-made libraries and sequenced either on Illumina Novaseq or Nextseq 500 instruments at the Functional Genomics Center Zurich ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Microbiology 2019Quote: ... which was denatured and run on the MiSeq sequencer at a final concentration of 5 pM alongside a 5 pM PhiX control (Illumina). Raw reads generated by MiSeq were error-corrected and filtered using DADA2 through QIIME2 (https://qiime2.org).38 Filtered reads were clustered de novo into Operational Taxonomic Units (OTUs ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2021Quote: ... with 5% (v/v) 20 pM PhiX (Illumina), using 150 cycle v3 cartridges ...
-
bioRxiv - Genomics 2019Quote: ... low call rate (> 5% low quality data [Illumina detection P>1×10−6 ...
-
bioRxiv - Genomics 2020Quote: ... Pre-capture libraries with less than 100 ng of double-stranded cDNA (n=5; PT0017_Qiagen_20ng_XTHS, PT0017_Covaris_20ng_XTHS, PT0017_Qiagen_20ng_Illumina, PT0017_Covaris_20ng_Illumina, Agilent_UHR_20ng_Illumina ...
-
bioRxiv - Physiology 2023Quote: ... In each sequencing run 5% of PhiX (Illumina) was included as an internal control ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).