Labshake search
Citations for Illumina :
1201 - 1250 of 2338 citations for 3 Hydrazino 5 methyl 4H 1 2 4 triazol 4 ylamine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Genomics 2023Quote: ... groups was based on 5 μg of total RNA according to the manufacturer’s protocol using the Illumina HiScanSQ Instrument (Illumina, USA) and sequenced in the same flow cell as paired-end (2 × 100 bp) ...
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled to a final concentration of 5-10 ng/µL and sequenced on a NextSeq 500 (Illumina). The demultiplexed data was assembled and SNPs detected with Pilon software using reference genome sequences.84
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified with AMPure XP purification kit and Sixteen-plexed samples were pooled in approximately equimolar amounts of 5 nM and run in a single and double index reads on a Hiseq 4000 (Illumina).
-
bioRxiv - Genomics 2022Quote: Small RNA libraries were prepared starting from 5 µL RNA eluate using the TruSeq Small RNA Library Prep Kit (Illumina, RS-200-0012 ...
-
bioRxiv - Pharmacology and Toxicology 2024Quote: The reverse transcription products (5 μL) were mixed with Eco™ Real-Time PCR System (Illumina, San Diego, CA, USA) and primers ...
-
bioRxiv - Developmental Biology 2024Quote: ... Gene expression and CRISPR libraries were prepared according to the CG000510 Chromium NextGEM Single Cell 5’ v2 CRISPR User Guide (Rev B, 10x Genomics) and sequenced on NextSeq and NovaSeq platforms (Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... The quality of each sequencing run was controlled by adding up to 5% of denatured and diluted down to 20pM PhiX (Illumina). Demultiplexing of the data by sample using the defined index pairs was performed automatically by Illumina BaseSpace.
-
bioRxiv - Evolutionary Biology 2024Quote: ... Denatured libraries were diluted to a final concentration of 12 pM and combined with 5 % PhiX control (V3 cat# 15017666 from Illumina). Paired-end sequencing was performed on an Illumina MiSeq with 2×150 bp reads (MiSeq Reagent Kit v2 600-cycle ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were prepared following 10X Genomics protocols (Chromium Single Cell 3’ Reagent Kits v2 Chemistry) and sequenced on NovaSeq 6000 (Illumina S2 flow cell, paired-end). FASTQ files were processed using cellranger (https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/what-is-cell-ranger ...
-
bioRxiv - Microbiology 2022Quote: ... and R2-Uni13 (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GAG TAG AAA CAA GG-3’) (adaptor and barcode oligonucleotide sequences from Illumina, Inc., San Diego, CA, USA). Annealing and extension steps were performed for 30 s at 55oC and 7 m at 72oC ...
-
bioRxiv - Immunology 2021Quote: ... Libraries were diluted to 2 nM and paired-end sequencing was performed on a HiSeq 2500 sequencer (Illumina). Stimulation libraries were diluted to 3nM and paired-end sequencing was performed on a NovaSeq 6000 (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... to determine library size and quantification before paired-end (2 × 41 bp) sequencing on a NextSeq 500 (Illumina) platform ...
-
bioRxiv - Developmental Biology 2021Quote: ... Adapters were trimmed and low quality sequences removed using trimmomatic and the requisite Illumina adapter sequences (trimmomatic v0.38; PE -threads 2 ILLUMINACLIP:Illumina_TrueSeq_Adapters_PE.fa:2:30:10 HEADCROP:1 MINLEN:31) ...
-
bioRxiv - Genomics 2022Quote: Paired-end DNA sequencing (2×151 bp) of the libraries was performed on the NovaSeq 6000 sequencer (Illumina) using the NovaSeq S4 Reagent Kit ...
-
bioRxiv - Genomics 2020Quote: ... on Illumina’s official website (ftp://webdata2:[email protected]/downloads/productfiles/humanomniexpress-24/v1-2/infinium-ommexpress-24-v1-2-mamfest-file-csv.zip) and converted it to a VCF format using Illumina’s GTCtoVCF tool (github.com/Illumina/GTCtoVCF).
-
bioRxiv - Genomics 2020Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Genomics 2020Quote: ... The library preparation and strand-specific paired-end sequencing (2 × 150 bp) on a HiSeq 4000 platform (Illumina) was performed by Novogene Co. ...
-
bioRxiv - Genomics 2021Quote: ... according to manufacturer”s instructions and sequenced using a 2 × 250-cycle MiSeq Reagent kit v3.0 (Illumina, CA).
-
bioRxiv - Microbiology 2021Quote: ... Libraries were then multiplexed and submitted to the sequencing platform (Illumina MiSeq, pair end 2 x 250 bp). Reads with less than 36 bp were discarded and adaptor sequences were removed by Macrogen Inc.
-
bioRxiv - Cancer Biology 2020Quote: ... the library was performed pair-end 2×100bp high-throughput sequencing using HiSeq 2500 and Nova-seq (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... lLibraries were diluted to 2 nM in 10 mM of TE and samples were sequenced with MiSeq (Illumina) using a paired-end approach ...
-
bioRxiv - Plant Biology 2020Quote: ... An initial sequencing run took place on a MiSeq 2 × 300bp run (v3) (Illumina, San Diego, California, USA) at the Field Museum of Natural History ...
-
bioRxiv - Microbiology 2020Quote: ... to a final concentration of 2 nM containing 15% PhiX V3 library control (Illumina, San Diego, CA, USA), the library pools were denatured for 5 min in an equal volume of 0.2M NaOH ...
-
bioRxiv - Microbiology 2021Quote: Raw data from the Illumina MiSeq was first converted into FASTQ format 2 × 312 paired-end sequence files using the bcl2fastq program (v1.8.4) provided by Illumina. Format conversion was performed without de-multiplexing ...
-
bioRxiv - Microbiology 2020Quote: ... Isolated RNA was heat fragmented and libraries were prepared for 2 × 250 nucleotide paired-end sequencing performed (Illumina). Genewiz performed basecalling and read demultiplexing.
-
bioRxiv - Microbiology 2020Quote: ... Paired-end sequences of 2 x 150 bp were generated for all libraries on the NovaSeq platform (Illumina). Metagenomic sequence reads are publicly available on the JGI IMG portal.
-
bioRxiv - Microbiology 2022Quote: Genomic DNA extraction and the sequencing library preparation for short-read 2×250 bp paired-end MiSeq (Illumina) sequencing was performed as described before (Valcek et al. ...
-
bioRxiv - Immunology 2022Quote: ... Equimolar amounts of each library were paired-end sequenced (2 × 38 bp) on a NextSeq 550 instrument (Illumina).
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Cell Biology 2022Quote: ... Paired-end 2×100 bp RNA-sequencing (Illumina TruSeq RNA Library Prep Kit, Illumina HiSeq2000 and Illumina HiSeq4000) was performed ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were sequenced using the NovaSeq SP Reagent kit (2 × 150 cycles) from Illumina (San Diego, CA, USA). Sample L5630 underwent a target enrichment approach where double stranded DNA (synthesized using the QuantiTect Reverse Transcription Kit from Qiagen ...
-
bioRxiv - Genomics 2020Quote: ... Finaly libraries were then pooled and diluted to 2 nM and subsequently sequenced using Illumina HiSeq 2500 (Illumina).