Labshake search
Citations for Illumina :
1151 - 1200 of 2336 citations for 7 trifluoromethyl 1 2 3 4 tetrahydro 5 nitroisoquinoline hydrochloride since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... Paired-end (2 x 150 bp) reads were collected using the NovaSeq 6000 S4 XP system (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... Barcoded libraries were pooled and paired-end sequenced (2×41 cycles) using the Illumina platform (NextSeq500, Illumina).
-
bioRxiv - Immunology 2022Quote: ... and sequenced with a 2×100 bp paired-end protocol on the HiSeq 4000 Sequencing System (Illumina).
-
bioRxiv - Developmental Biology 2023Quote: ... Add (batch-determined actitivty) 2 to 2.5 uL of Nextera Tn5 transposase (Cat# FC-121-1030, Illumina. Samples were incubated at 37C for 30 minutes in a thermomixer at 500 RPM shaking ...
-
bioRxiv - Molecular Biology 2023Quote: ... The obtained amplicons of about 200 bp were sequenced (Illumina MiSeq v2 2×150pb, paired-end reads) and the resulting FASTQ data subjected to QC using Cutadapt (1.12) ...
-
bioRxiv - Microbiology 2023Quote: ... with paired-end reads (2×150-250) on a MiSeq system using v2 sequencing reaction chemistry (Illumina). The resulting sequencing reads were analyzed in CLC Genomics 21.0 (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were sequenced using 2 x 300 bp paired end v3 reagent kit (Illumina, following manufacturer’s protocols). Short read paired-end data were filtered ...
-
bioRxiv - Genomics 2022Quote: ... Next-gen sequencing (2 × 150 bp paired end reads) was performed on a NovaSeq 6000 instrument (Illumina). Adapter sequences and poor quality reads were filtered with Trimmomatic v34 (Bolger et al ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... cDNA libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA). Sequencing was performed on an Illumina HiSeq XTen/NovaSeq/BGI platform by a commercial service (Biomarker Technologies ...
-
bioRxiv - Molecular Biology 2023Quote: Sequencing library preparation for RNA-seq was done using the TruSeq™ 2 (Illumina, RS-122-2001) kit ...
-
bioRxiv - Genetics 2023Quote: ... Libraries were prepared using the TruSeq DNA sample preparation version 2 low-throughput (LT) protocol from Illumina with the following modifications ...
-
bioRxiv - Cell Biology 2023Quote: ... 2 μg of total RNA was used for library preparation (Illumina TruSeq Stranded total RNA Ribo-Zero) with four biological replicates per experimental group ...
-
bioRxiv - Microbiology 2023Quote: ... An Illumina NextSeq sequencer was applied for generation of paired-end fragment reads (2 × 150 nucleotides) and bcl2fastq software (v2.17.1.14; Illumina) was applied for primary data analysis (base-calling) ...
-
bioRxiv - Immunology 2023Quote: ... for 2 × 250 cycles using MiSeq PE cluster generation kits and MiSeq SBS Kit sequencing reagents (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... and sequenced on a HiSeq 4000 using a 2×150bp Paired End configuration (Illumina, La Jolla, CA), targeting 50 million paired-end reads per library ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were then sequenced for 2 x 150 paired-end reads on either a NovaSeq 6000 (Illumina) with the WUSTL Genome Technology Access Center or Nextseq 550 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... we utilized both commercial adapters (N802, VAHTS DNA Adapters Set 2 for Illumina, Vazyme Biotech, Nanjing, China) and modified adapters inspired by a previous study 13 ...
-
bioRxiv - Genomics 2023Quote: ... Three runs of paired-end (2 x 150 bp) sequencing were performed on an Illumina MiSeq (Illumina) to generate 25 Gbp of raw data ...
-
bioRxiv - Genomics 2024Quote: ... Paired end (2 × 250 nucleotides) sequencing of the library was performed in a Novaseq 6000 (Illumina Inc.) next-generation DNA sequencer ...
-
bioRxiv - Cell Biology 2024Quote: ... The paired-end RNA sequencing (2 x 150 bp) was performed on a HiSeq 4000 system (Illumina). The sequencing data were converted from base call files to FASTQ files using Illumina’s bcl2fastq v2.2.0 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the MiSeq Reagent Kit v3 supporting 600-cycles of 2 x 300 paired-end reads (Illumina). The resulting sequence reads were filtered following a cut-off of Phred quality scores ≥30 and read length ≥75 bases ...
-
bioRxiv - Genetics 2021Quote: ... Individual libraries were pooled in equimolar ratio (4 nM for each) and sequenced with the Nextseq 550 platform (Illumina, San Diego, California) in a single end 75 cycles high output run ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Libraries were diluted from 26.2 nM (HBA1) and 33.4 nM (HBA2) to a concentration of 4 nM and pooled for sequencing on a MiSeq (Illumina, San Diego, CA).
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Microbiology 2021Quote: PCR free shotgun libraries were prepared for each sample from 2.5 ug metagenomic DNAs by Exeter Sequencing Service for the metagenomic sequencing using the TruSeq DNA library Prep Kit (Illumina). The libraries were sequenced to approximately 7GBp using the HiSeq 2500 rapid run mode (2X 250 bp paired end ...
-
Diversified expression of gamma-protocadherins regulates synaptic specificity in the mouse neocortexbioRxiv - Neuroscience 2021Quote: We acquired 212.66 GB clean reads for the 5’ gene expression library and 183.30 GB for the 5’ pcdhg expression library from the sequencing platform NovaSeq 6000 (Illumina, Novogene). 5’ gene expression sequencing data were aligned by Cellranger v3.0.2 (10X Genomics) ...
-
bioRxiv - Immunology 2019Quote: ... and a mixture of 8 VH family and IgM-specific primers (listed below) containing 5’ adaptors to allow barcoding by the Illlumina TruSeq multiplex pcr kit (Illumina). Resulting PCR products were subjected to 10 cycles of PCR using Illumina TruSeq indexing primers ...
-
bioRxiv - Genomics 2021Quote: ... cDNA and barcode libraries were checked for quality on an Agilent 4200 TapeStation, quantified by KAPA qPCR, and sequenced on a single lane (95% transcriptome, 5% barcode) on Novaseq6000 (Illumina) to an average depth of 100,000 reads per cell.
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Microbiology 2021Quote: ... a PhiX spike-in of 2.5-5% was added to the pools (PhiX Sequencing Control v3; Illumina # FC-110-3001). Samples were run on the Illumina NextSeq 500 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Animal Behavior and Cognition 2022Quote: ... 5’ CGT ACA GCG GCT TGT TGG CTG TGA, and fA23M, 5’ GCG CTC CAG CTC CTT CTG CCC ATA, primers to which the Illumina sequencing primer sequences were attached to their 5’ ends) ...
-
bioRxiv - Microbiology 2022Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110-3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Cancer Biology 2020Quote: Genomic DNA from 28 samples in which scDNA-seq data showed at least 5% of homozygously mutated clones were analyzed by Illumina Omni2.5-8 SNP array ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were isolated from 100,000 cells and sequencing adapters were transposed for 30 minutes at 37°C using 5 μl of TDE1 (Nextera Tn5 transposase, Illumina). After PCR and gel purification ...
-
bioRxiv - Genomics 2021Quote: ... The samples were amplified for 5-8 cycles as determined by qPCR for Illumina sequencing using Nextera library preparation kit (Illumina) and samples were paired-end sequenced on HiSeq4000 ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Physiology 2021Quote: ... Single-indexed strand-specific cDNA library from total RNA samples (500 ng input with RIN ≥ 5) was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina) as per directions by the manufacturer ...
-
bioRxiv - Microbiology 2021Quote: ... 1.5 μg of purified RNA for each sample was processed using the Ribozero rRNA Removal Kit (Gram-negative bacteria) (Illumina) according to the manufacturer’s instructions except that reaction volumes were reduced by 50% ...
-
bioRxiv - Genetics 2021Quote: ... and ribosomal RNA was depleted from 5 ug of total RNA using the Ribo-Zero™ Gold Kit (Illumina, Inc.). Depleted mRNA was fragmented and converted to first strand cDNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2019Quote: ... Ribosomal RNA (rRNA) was then depleted from each sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Immunology 2020Quote: ... 0.3 to 0.5 ng of pre-amplified cDNA was used to generate barcoded Illumina sequencing libraries (Nextera XT library preparation kit, Illumina) in an 8μL reaction volume ...
-
bioRxiv - Genomics 2021Quote: ... The 20 ul preamp was then mixed with 25 ul TD buffer and 5 ul TDE1 buffer (Nextera kit, FC-131-1096, Illumina) and incubated for 5 min at 55 C and held at 10 C ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA (rRNA) was subsequently depleted from each RNA sample (5 µg each) using the bacterial Ribo-Zero rRNA Removal Kit (Illumina). The integrity of the RNA was evaluated using an RNA 6000 Nano LabChip and an Agilent 2100 Bioanalyzer (Agilent Technologies ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...