Labshake search
Citations for Illumina :
1051 - 1100 of 9201 citations for hsa mir 296 5p Real time RT PCR Detection Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... A TruSeq DNA Library Preparation Kit (Illumina) was used for cDNA library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The NexteraXT DNA Library Preparation Kit (Illumina) was used to generate sequencing libraries (1/5th of the recommended volume) ...
-
bioRxiv - Microbiology 2023Quote: ... the Illumina TruSeq Stranded mRNA kit (Illumina) was used to build the null mutant and IP libraries ...
-
bioRxiv - Genetics 2023Quote: ... the TruSeq DNA Methylation Kit (Illumina Inc.) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... using TruSeq ChIP Sample Preparation Kit (Illumina) or ThruPLEX® DNA-seq Kit (Rubicon Genomics ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Illumina Nextera kit (Illumina, San Diego, CA) was used for library preparation and the samples were sequenced with NextSeq 550 platform ...
-
bioRxiv - Genomics 2023Quote: The Nextera XT Index Kit (Illumina Inc.) was used for the first amplicon generation followed by NGS library preparation of the QC passed samples ...
-
bioRxiv - Genomics 2023Quote: ... the TruSeq Ribo Profile (Mammalian) Kit (Illumina) was used in accordance with the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were prepared using TruSeq Kit (Illumina). RNA-sequencing (30 million reads per sample ...
-
bioRxiv - Bioengineering 2023Quote: ... Illumina TruSeq RNA stranded kit (Illumina, US) was used for library preparation ...
-
bioRxiv - Cancer Biology 2022Quote: The TruSight Oncology 500 Kit (TSO500, Illumina) was used for DNA library preparation and enrichment following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were barcoded (Nextera Index Kit, Illumina) and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... using the MiSeq Reagent Kit v3 (Illumina) and paired-end 300bp chemistry ...
-
bioRxiv - Immunology 2023Quote: ... using the TruSeq SBS Kit v4 (Illumina). An average of 42 million paired reads were generated per sample and the percent of mRNA bases per sample ranged from 73% to 84%.
-
bioRxiv - Immunology 2023Quote: ... or HiSeq 3000/4000 SBS Kit (Illumina). An average of 100 million paired reads were generated per sample.
-
bioRxiv - Microbiology 2023Quote: ... the TruSeq Stranded Library Preparation kit (Illumina) was used to prepare the sequencing library ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... The Nextera XT Sample Prep kit (Illumina) and Nextera XT Index kit v2 (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... Human Ribo-Zero rRNA depletion kit (Illumina). Paired-end 150+150 bp sequencing was performed at the Institute for Molecular Medicine Finland FIMM Genomics unit with Illumina NovaSeq 6000 using partial S4 flow cell lane ...
-
bioRxiv - Cancer Biology 2023Quote: ... Ligation Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... a P2 reagent kit (100 cycles) (Illumina) was used for NGS.
-
bioRxiv - Neuroscience 2023Quote: ... library quantification (KAPA Library Quantification Kit Illumina, Kapa Biosystems ...
-
bioRxiv - Genetics 2023Quote: ... unique dual indices (from Illumina TruSeq kits), P5 and P7 adaptor sequences are from Illumina Adaptor Sequences Document # 1000000002694 v16.
-
bioRxiv - Immunology 2023Quote: ... Ligation with Ribo-Zero Plus kit (Illumina) and IDT for Illumina RNA UD Indexes Set A ...
-
bioRxiv - Neuroscience 2023Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2023Quote: ... 500 cycle kit (Illumina; San Diego, CA).
-
bioRxiv - Immunology 2023Quote: ... using a NextSeq P2 sequencing kit (Illumina) with a target depth of 5 million reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... utilizing a MiSeq reagent kit v2 (Illumina). Subsequently ...
-
bioRxiv - Microbiology 2023Quote: ... Ribo-Zero Plus rRNA Depletion Kit (Illumina) was applied according to manufacturers’ instructions ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... TruSeq RNA Sample Preparation Kit v2 (Illumina) was used to prepare libraries for 100 bp paired-end RNA-seq ...
-
bioRxiv - Developmental Biology 2023Quote: ... The Nextera DNA Library Preparation Kit (Illumina) was used to perform the transposition according to the manufacturer’s manual ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and Nextera XT Index kit v2 (Illumina) were used to produce paired-end DNA libraries using half-volume reactions ...
-
bioRxiv - Cancer Biology 2023Quote: ... using a 200 cycle SBS kit (Illumina) with paired-end reads at 101 bp length targeting >60 million reads per sample.
-
bioRxiv - Molecular Biology 2023Quote: ... the TruSeq Small RNA Prep Kit (Illumina) was used to prepare small RNA libraries from RNA pyrophosphohydrolase (Rpph ...
-
bioRxiv - Immunology 2024Quote: ... The Nextera XT Index Kit v2 (Illumina) was used to add the dual-barcoded adaptors ...
-
bioRxiv - Animal Behavior and Cognition 2023Quote: ... v3 600 Cycles Reagent Kit (Illumina, U.S.A.).
-
bioRxiv - Microbiology 2024Quote: ... The Nextera XT library construction kit (Illumina) was used to generate sequencing libraries following the manufacturer’s recommended protocol ...
-
bioRxiv - Synthetic Biology 2024Quote: ... v3 reagent kit (Illumina, MS-102-3003). Raw FASTQ files were aligned to a FASTA-format reference file containing the expected amplicon sequences ...
-
bioRxiv - Molecular Biology 2024Quote: ... 100 cycle sequencing kit v1.5 (Illumina Inc.). Basecalling was done by Illumina RTA3 and output was demultiplexed and converted to fastq format with bcl2fastq v1.9.0.
-
bioRxiv - Cancer Biology 2024Quote: ... 100-500 ng of total RNA underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA HT Kit, Illumina #20020595), with 15 cycles of PCR ...
-
bioRxiv - Genomics 2020Quote: ... sgRNA libraries were generated using two-step PCR and sequenced by paired-end sequencing using a NextSeq 500 (Illumina).
-
bioRxiv - Immunology 2021Quote: ... and amplicons were used to perform the index PCR using the Nextera XT index v2 (Illumina #FC-131-1002). The index PCR products were cleaned with the Agencourt AMPure XP kit (Beckman Coulter #A63881 ...
-
bioRxiv - Cancer Biology 2019Quote: ... Genomic DNA from these cells was used for PCR amplification of sgRNAs and sequenced using a MiSeq system (Illumina). Fold depletion or enrichment of sgRNAs from the NGS data was calculated using PinAplPy software38.
-
bioRxiv - Microbiology 2019Quote: ... The resulting PCR products were purified and loaded onto the Illumina MiSeq cartridge (Illumina Inc., San Diego, Ca, USA).
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... The second round of PCR followed the manufacturer’s guidelines for 16S rRNA Metagenomic Sequencing Library protocol (Illumina, Cat.: 150442223) for the MiSeq system ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR reactions were sent to the @Bridge platform (INRAe, Jouy-en-Josas, france) for sequencing (Illumina Miseq technology). Single multiplexing was performed using home-made 6 bp index ...
-
bioRxiv - Cancer Biology 2022Quote: ... The first PCR aims to amplify genotyping fragments prior to sample indexing and uses P5 (binds the P5 Illumina sequencing handle ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clean PCR amplicons from the same DNA sample were pooled to generate 137 libraries that were sequenced by Illumina MiSeq v3 ...