Labshake search
Citations for Illumina :
1001 - 1050 of 9186 citations for Onion Yellow Dwarf Virus OYDV PCR Kits since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: The TruSight Oncology 500 Kit (TSO500, Illumina) was used for DNA library preparation and enrichment following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were barcoded (Nextera Index Kit, Illumina) and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... using the MiSeq Reagent Kit v3 (Illumina) and paired-end 300bp chemistry ...
-
bioRxiv - Immunology 2023Quote: ... using the TruSeq SBS Kit v4 (Illumina). An average of 42 million paired reads were generated per sample and the percent of mRNA bases per sample ranged from 73% to 84%.
-
bioRxiv - Immunology 2023Quote: ... or HiSeq 3000/4000 SBS Kit (Illumina). An average of 100 million paired reads were generated per sample.
-
bioRxiv - Evolutionary Biology 2024Quote: ... or spleen using QuickExtract kits (Epicentre, Illumina) provided input for both WGBS library preparation (150 ng ...
-
bioRxiv - Immunology 2024Quote: ... using a P3 100 cycle kit (Illumina), paired end run with the following run parameters ...
-
bioRxiv - Immunology 2024Quote: ... using a NextSeq P2 sequencing kit (Illumina) with a target depth of 5 million reads per sample ...
-
bioRxiv - Genetics 2024Quote: ... unique dual indices (from Illumina TruSeq kits), P5 and P7 adaptor sequences are from Illumina Adaptor Sequences Document # 1000000002694 v16.
-
bioRxiv - Neuroscience 2024Quote: ... through NextSeq 500/550 v2.5 Kit (Illumina) with 1 × 150 bp read length and 400 M maximum reads per run ...
-
bioRxiv - Microbiology 2024Quote: ... using Nextera Library Prep Kit (Illumina, USA), with 2×150bp chemistry ...
-
bioRxiv - Immunology 2024Quote: ... Libraries were barcoded (Nextera Index Kit, Illumina) and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2024Quote: ... using a MiSeq Reagent kit v3 (Illumina) following the standard guidelines for preparing and loading samples on the MiSeq ...
-
bioRxiv - Physiology 2024Quote: ... Ligation Kit from Illumina (San Diego, CA). The expression level of each transcript was calculated using the transcripts per million reads (TPM) ...
-
bioRxiv - Pathology 2024Quote: ... using Nextera XT index kit (Illumina, USA). After amplicons purification ...
-
bioRxiv - Molecular Biology 2024Quote: ... The Nextera DNA XT kit (Illumina, Inc.) was used for library preparation and sequencing was conducted using the v2 kit with 500 cycles for a read length of 2 x 250 bp.
-
bioRxiv - Genomics 2024Quote: ... and index primers from Nextera Kit (Illumina), and analysed using a TapeStation 2200 with High Sensitivity D1000 ScreenTape (Agilent) ...
-
bioRxiv - Genomics 2024Quote: ... The TruSeq ChIP Library Preparation Kit (Illumina) was used to make libraries that were sequenced on the NovaSeq 6000 platform from Illumina ...
-
bioRxiv - Plant Biology 2024Quote: ... using Reagent Kit v3 (50 cycles) (Illumina) on Illumina MiSeq ...
-
bioRxiv - Genetics 2024Quote: ... using a NextSeq P2 sequencing kit (Illumina) with a target depth of 5 million reads per sample.
-
bioRxiv - Cell Biology 2024Quote: ... and the high-output kit v2 (Illumina), followed by sequencing on a NextSeq 500 sequencer (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the S1 100 reagent kit (Illumina) with 1% PhiX ...
-
bioRxiv - Developmental Biology 2024Quote: ... A TruSeq RNA sample preparation kit (Illumina) was used for template preparation ...
-
bioRxiv - Genomics 2020Quote: ... sgRNA libraries were generated using two-step PCR and sequenced by paired-end sequencing using a NextSeq 500 (Illumina).
-
bioRxiv - Immunology 2021Quote: ... and amplicons were used to perform the index PCR using the Nextera XT index v2 (Illumina #FC-131-1002). The index PCR products were cleaned with the Agencourt AMPure XP kit (Beckman Coulter #A63881 ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... The second round of PCR followed the manufacturer’s guidelines for 16S rRNA Metagenomic Sequencing Library protocol (Illumina, Cat.: 150442223) for the MiSeq system ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR reactions were sent to the @Bridge platform (INRAe, Jouy-en-Josas, france) for sequencing (Illumina Miseq technology). Single multiplexing was performed using home-made 6 bp index ...
-
bioRxiv - Cancer Biology 2022Quote: ... The first PCR aims to amplify genotyping fragments prior to sample indexing and uses P5 (binds the P5 Illumina sequencing handle ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clean PCR amplicons from the same DNA sample were pooled to generate 137 libraries that were sequenced by Illumina MiSeq v3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by limited PCR enrichment to generate the final cDNA sequencing library (Nextera® XT DNA Library Prep, Illumina). Libraries were sequenced as single-end 75 base pair reads on the Illumina NextSeq500 per the manufacturer’s instructions.
-
bioRxiv - Genetics 2020Quote: ... Serial PCRs were performed for targeted deep sequencing and then a MiniSeq sequencing platform (Illumina, San Diego, CA, USA) was used for next generation sequencing (NGS) ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were then purified and sequenced on Illumina HiSeq 2500 platform (Illumina Inc., San Diego, CA, USA) via a paired-end approach (2 × 250 bp) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Purified DNA was amplified for library construction with PCR using Nextera i5 common adaptor and i7 index adaptors (Illumina). The final libraries were sequenced on Illumina HiSeq 4000.
-
bioRxiv - Microbiology 2022Quote: ... Paired-end sequencing (2×150 bp) and PCR-free whole genome sequencing was performed on a HiSeq X (Illumina) 54 ...
-
bioRxiv - Genetics 2024Quote: ... according to the manufacturer’s instructions at a final primer concentration of 250 nM in Eco Real-Time PCR System (Illumina) under the following conditions ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR was performed using unique dual index primer pairs (NEBNext Multiplex Oligos for Illumina from New England BioLabs, # E6440S) according the following parameters ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR products were purified and either analysed by Sanger sequencing (Mix2seq, Eurofins Genomics, Germany) or Next-Generation Sequencing (Illumina, NGSelect Amplicon ...
-
bioRxiv - Microbiology 2023Quote: ... The PCR products were used for library construction and sequenced on the NovaSeq PE250 platform (Illumina, San Diego, USA) according to the protocol of Majorbio Bio-Pharm Technology Co ...
-
bioRxiv - Molecular Biology 2024Quote: ... including PCR cycles (12 cycles for cDNA amplification of 5000 cells and 14 cycles for index PCR. E13.5GE libraries from Evf2+/+and Evf2TS/TS were sequenced on the Illumina NovaSeq 6000 (Sequencing Core Facility at the La Jolla Institute).
-
bioRxiv - Developmental Biology 2022Quote: ... The PCR product was purified in a 1 % agarose gel and sequenced using a NextSeq 550 and NovaSeq (Illumina) to obtain 79+79-nt ...
-
bioRxiv - Developmental Biology 2022Quote: ... cDNA synthesis was performed with 12 PCR cycles and the rest of the library preparation was performed according to the manufacturer’s instructions (10X Genomics, Illumina). All libraries were sequenced on an Illumina NovaSeq 6000 using S4 to a target sequencing depth of 100,000 reads/cell ...
-
bioRxiv - Genetics 2023Quote: ... PCR-enriched junctions were deep-sequenced using next-generation sequencing (NGS) technologies (Illumina MiSeq v3 single-end 150 cycles) (Figure S5).
-
bioRxiv - Immunology 2024Quote: ... We then searched for (TRA or TRB) PCR targets isolated using Illumina MiSeq sequencing (sequencing platform keyword: “Illumina MiSeq”); on manual inspection ...
-
bioRxiv - Molecular Biology 2024Quote: ... The PCR product was purified from a 1% agarose gel and sequenced using a NextSeq 550 or NovaSeq (Illumina) to obtain 79+79-nt or 150+150-nt ...
-
bioRxiv - Genomics 2024Quote: ... 0.3fmol of indexed tagged library were sequenced with 14 PCR cycles before quantifying and sequencing on a NovaSeq6000 (Illumina) with 150bp PE reads to give a median 0.9x duplex coverage ...
-
bioRxiv - Genomics 2024Quote: ... 40.4 M short reads were generated from an Illumina DNA PCR-Free library (Illumina, Inc. for research use only) prepared according to manufacturer’s instructions and Megahit v1.2.9 was used for de novo assembly ...
-
bioRxiv - Cancer Biology 2024Quote: ... 19086) and amplified using 2.5 µl of Universal PCR primer (NEBNext Multiplex Oligos for Illumina, NEB, cat. no. E6861A), 2.5 µl of indexed primers (NEBNext Multiplex Oligos for Illumina ...
-
bioRxiv - Immunology 2021Quote: ... High-quality RNA was processed using an Illumina TruSeq RNA sample prep kit v2 or TruSeq Small RNA Sample Prep kit following the manufacturer’s instructions (Illumina). Clusters were generated using TruSeq Single-Read Cluster Gen ...