Labshake search
Citations for Illumina :
1001 - 1050 of 9767 citations for Human Probable fructose 2 6 bisphosphatase TIGAR TIGAR ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were sequenced 2 x 150 paired end using a NovaSeq 6000 instrument (Illumina) to get 30x coverage on the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Bioengineering 2023Quote: ... Libraries were then sequenced on NextSeq 500 Mid Output with 2×150 bp (Illumina). The Cell Ranger VDJ pipeline was used for sample de-multiplexing and barcode processing.
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end reads (2 x 150 bp) were on a HiSeq 3000 instrument (Illumina). Sequencing reads were first quality trimmed and filtered with Trimmomatic (version 0.36 ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Libraries were subsequently sequenced on a NovaSeq S2 Flowcell (paired end 2×56bp) (Illumina). All samples in this study were prepared and sequenced at the same time ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with 2×150 bp paired-end reads on a NovaSeq platform (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Microbiology 2024Quote: ... using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina). A subset of 100,000 reads was sampled for each phage ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were pooled and sequenced in (2 x 100bp) on the NovaSeq-6000 (Illumina). Gene and ERV expression was quantified as described (11,31 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Immunology 2021Quote: ... DNA libraries were prepared using the Nextera XT DNA Library Preparation Kit and Nextera Index Kit (Illumina) following the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina). Multiplexed libraries were pooled and paired-end 150-bp sequencing was performed on the Illumina HiSeq 4000 platform at Sidra Medicine ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA depletion was performed (rRNA depletion Kit Ribo Zero Magnetic Kit for Gram-positive bacteria; Epicentre [Illumina]) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified using Ovation V2 kit (NuGEN) and sequencing libraries were generated using NexteraXT kit (Illumina). RNA-seq was carried out on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2020Quote: ... and libraries were constructed using a kit (NEB Ultra DNA library kit for Illumina; catalogue number E7370L), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were made using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold Kit (Illumina). These libraries were sequenced using Illumina HiSeq platform with 100 bp single read at a depth of 10-20 million reads per sample.
-
bioRxiv - Microbiology 2022Quote: ... and libraries prepared using the NexteraXT kit and sequenced using HiSeq 1 × 150-cycle v3 kit (Illumina). The operational taxonomic unit (OTU ...
-
bioRxiv - Genomics 2022Quote: ... the TruSeq Stranded Total RNA Sample Preparation Kit and ScriptSeq v2 RNA-seq library preparation kit (Illumina) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were generated using TruSeq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina) as per manufacturer instructions ...
-
bioRxiv - Physiology 2023Quote: ... was purchased from Beckman Coulter. TruSeq PE Cluster Kit v3-cBot-HS kit (cat. PE-401-3001) was purchased from Illumina. Biospin Tissue Genomic DNA extraction Kit (cat ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75□bp paired-end sequencing method (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 500-cycle MiSeq Reagent Kit v2 or 600-cycle MiSeq Reagent Kit v3 (Illumina, California, United States), creating 2 × 150 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the NextSeq 500/550 High Output Kit v2.5 (300 Cycles) kit (cat. no. 20024908) (Illumina Inc.). The quality of the sequencing outputs was controlled using FastQC version 0.11.9 (Simon ...
-
bioRxiv - Genomics 2019Quote: DNA was extracted and genotyped from a total of 867 samples (START mothers) using the Illumina Human CoreExome-24 and Infinium CoreExome-24 arrays (Illumina, San-Digeo, CA, USA). Data was cleaned using standard quality control (QC ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA sequencing libraries were generated according to the manufacturer’s instructions for the TruSeq totalRNA with RiboZero Human/Mouse/Rat Gold (Illumina, San Diego, CA, United States). Sequencing was then performed on the NovaSeq6000 (Illumina ...
-
bioRxiv - Genetics 2024Quote: ... Bisulfite-converted DNA samples were randomly assigned to a chip well on the Infinium Human Methylation EPIC v2 BeadChip (Illumina, Inc., San Diego, CA) or in the Human Imprintome array BeadChip (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... was shipped on dry ice to the UCLA Neurogenomics Core facility (Los Angeles, CA) for analysis using Illumina HT-12 v4 human microarrays (Illumina Inc., San Diego, CA). The order of the sections was randomized prior to shipment to avoid confounding potential technical artifacts with potential biological gradients of gene expression ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the HiSeq PE Rapid Cluster Kit v2 and HiSeq Rapid SBS Kit v2 (200 cycles, Illumina, USA) in the 100bp pair-end mode.
-
bioRxiv - Genomics 2021Quote: ... Cluster generation was performed using HiSeq SR Cluster Kit v3 cBot kits (Illumina Inc, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) or NovaSeq 6000 S4 Reagent Kit v1.0 (100 cycles) (Illumina) following manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc. ...
-
bioRxiv - Microbiology 2021Quote: ... a combined kit for the ribosomal (rRNA) depletion Ribo-Zero™ Kit (Bacteria) (Epicentre, Illumina, Madison, WI USA) and cDNA library construction kit ...
-
bioRxiv - Genetics 2022Quote: ... rRNA was depleted with EPiCenter Ribo-Zero Magnetic Gold Kit (Yeast) RevA kit (Illumina Inc, San Diego, CA), and the remaining RNA was purified using Agencourt RNACleanXP (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... using the HiSeq 3000/4000 SBS Kit or NovaSeq 6000 SP or S2 Reagent Kit (100 Cycles) (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... using the HiSeq 3000/4000 SBS Kit or NovaSeq 6000 S2 or S4 Reagent Kit (200 Cycles) (Illumina). An average of 64 million paired reads were generated per sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA samples were further processes according to the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the HiSeq 2500 (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Small RNA libraries were diluted to 2 nM and run on a miSeq System (Illumina) for NGS using the V2 kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were then sequenced with 2×150bp paired-end reads on an Hiseq3000 instrument (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... followed by paired-end sequencing (2 x 75 bp) performed with Nextseq 500 (Illumina, USA). Libraries were sequenced in triplicate ...
-
bioRxiv - Genomics 2020Quote: ... The samples were then sequenced (2×101 cycles, paried end reads) on the HiSeq2500 (Illumina) using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2×150bp paired-end sequencing (PE150) was performed on an Illumina Novaseq™ 6000 (Illumina) following the vendor’s recommended protocol.
-
bioRxiv - Genomics 2020Quote: ... Paired end libraries (2×150 bp) were sequenced on an Illumina HiSeq4000 instrument (Illumina Inc.).
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).