Labshake search
Citations for Illumina :
951 - 1000 of 1072 citations for pMHC1 150 since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2021Quote: ... Prepared library was loaded into Illumina platform for cluster generation and sequencing was performed using paired-end (PE) 2×150 bp library on Illunima platform (Illumina TruSeq RNA 500) (Bolger et al. ...
-
bioRxiv - Plant Biology 2021Quote: ... Paired-end (2 × 150 bp) sequencing of the cDNA libraries was performed on the Illumina HiSeq 2000 (Illumina Inc., San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: Paired-end DNA and cDNA libraries (2 × 150 bp) were constructed using TruSeqTM DNA Sample prep kit (Illumina Inc., San Diego, CA, USA) and TruSeqTM RNA Sample prep kit (Illumina Inc. ...
-
bioRxiv - Microbiology 2020Quote: ... Paired-end short reads were obtained on a MiSeq sequencer with paired-end v2 Micro chemistry and 150 cycles (Illumina, San Diego, CA). The library was constructed using the NEXTflex Rapid DNA-Seq kit (Bioo Scientific ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on an Illumina NextSeq sequencing system using NextSeq 500 Mid- and High-Output 150 cycle kits (75 bp, paired-end; Illumina, San Diego, CA). Quality control was performed on the raw reads using RNA-SeQC (v1.1.7) ...
-
bioRxiv - Cell Biology 2021Quote: ... and pooled before paired-end 150-base-pair sequencing on one lane of an Illumina NovaSeq 6000 sequencer (Illumina, Inc., San Diego, USA), which generated 3 million reads per samples ...
-
bioRxiv - Pharmacology and Toxicology 2022Quote: ... one RNA pool of 5 livers from each treatment and sex were independently subjected to sequencing (Illumina Novaseq 6000 paired-end (2×150)) ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries of 3 nM and above concentration were loaded on to NovaSeq 6000 S4 Reagent Kit using a paired-end 150 kit (20012866; Illumina, San Diego, CA). Each sample was sequenced to a depth of at least 19.5 million reads ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Molecular Biology 2022Quote: ... and approximately 150 ng of RNA was subjected to rRNA depletion using the Ribo-Zero Gold rRNA Removal Kit (Yeast) (Illumina MRZY1324, now discontinued). Libraries were prepared using the TruSeq Stranded Total RNA kit (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... The barcoded libraries were then pooled at equimolar ratios and sequenced on a NextSeq500/550 instrument (Illumina, 150 cycles High Output kit v2.0) to generate 150-bp single-end reads ...
-
bioRxiv - Molecular Biology 2022Quote: Pooled libraries were subjected to 150 bp paired-end sequencing according to the manufacturer’s protocol (NovaSeq 6000, Illumina, Inc., San Diego, CA, USA). Bcl2fastq2 Conversion Software (Illumina Inc. ...
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... All samples and all libraries were of good quality and 75 bp single end reads were generated for each library using the Illumina NextSeq®500 v2.5 High-output 150 cycle kit (Illumina Inc., Cambridge, UK). A total of 153,887,020 reads were generated for the 36 samples (4,274,639 ± 1,905,806 reads per sample).
-
bioRxiv - Pharmacology and Toxicology 2021Quote: ... and 75 bp paired-end reads were generated for each library using the Illumina NextSeq®500 v2.5 High-output 150 cycle kit (75bp paired-end reads, Illumina Inc., Cambridge, UK). A total of 455,308,427 reads (average of 12,647,456 ± 2,461,518 reads per sample ...
-
bioRxiv - Genomics 2020Quote: ... library according to the standard protocol for Illumina with an average insert size of 150 bp and was sequenced using an Illumina HiSeq 2000 (Illumina, San Diego, USA). For Single Molecule Real Time (SMRT ...
-
bioRxiv - Zoology 2021Quote: ... The library was sequenced with 150 bp paired-end reads in one lane of an Illumina HiSeq X (Illumina, San Diego, CA, USA). The RAD-Seq data were analyzed using the Stacks program (version 2.52 ...
-
bioRxiv - Microbiology 2021Quote: Metagenomic libraries (2×150 paired-end) were prepared and sequenced on an Illumina NextSeq 500 sequencing platform (Illumina Inc., San Diego, CA, USA). Quality of the reads and presence of adaptor sequences were checked using FastQC v.0.11.5 (Andrews ...
-
bioRxiv - Genomics 2021Quote: ... The transcriptomic library was prepared using Illumina TruSeq Stranded Total RNA library preparation kit with Ribo-Zero workflow and 150 bp paired-end reads were generated on Illumina Novaseq 6000 instrument (Illumina Inc., CA, USA). The detailed information related to species identification and DNA-RNA extraction is mentioned in Supplementary Notes 1.
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... The final library pool was sequenced twice on the NextSeq500 at 1.1pM and 75bp paired-end reads were generated for each library using the Illumina NextSeq®500 v2.5 High-output 150 cycle kit (Illumina Inc., Cambridge, UK). A total of 319,920,579 reads (average of 13,330,024 ± 3,068,802 reads per sample ...
-
bioRxiv - Cancer Biology 2021Quote: ... scRNA-libraries were sequenced on a NextSeq 500/550 High Output Flow Cell v2.5 (150 Cycles) on an Illumina NextSeq 550 (Illumina, San Diego, CA, USA). The bcl2fastq function and the cell ranger (v3.0 ...
-
bioRxiv - Immunology 2020Quote: ... University of Edinburgh using the NextSeq 500/550 High-Output v2 (150 cycle) Kit (# FC-404-2002) with a High Out v2.5 Flow Cell on the NextSeq 550 platform (Illumina Inc, #SY-415-1002). 8 libraries were combined in an equimolar pool based on the library quantification results and run across one High-Output Flow Cell ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were sequenced using the MiSeq 2×250 bp and HiSeq 2×150 bp paired-end read technology (Illumina, San Diego, CA, USA) as previously described [78] ...
-
bioRxiv - Immunology 2021Quote: ... A pair-end 150 bp sequencing was performed to produce high-quantity data on an Illumina HiSeq platform(Illumina, San Diego, California, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... The pooled library was sequenced on a MiSeq Illumina platform via 2×150 nt paired-end sequencing using the 300 cycle v2 kit (Illumina, #MS-102-2002).
-
bioRxiv - Microbiology 2023Quote: Extracted DNA for all samples was sent to The Center for Applied Genomics (Toronto, Canada) for shotgun metagenome sequencing using an Illumina HiSeq platform with paired 2 × 150 bp reads (Illumina, San Diego, CA). Metagenomic reads were quality trimmed using bbduk in the BBTools suite (https://sourceforge.net/projects/bbmap/ ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 ng RNA was reverse transcribed to create a library (Smart-Seq v4 Ultra Low Input RNA / cDNA library) which was sequenced to generate 50 million read pairs (150 bp paired reads) (Illumina NovaSeq 6000 PE150). A total of 42 RNA samples processed by Novogene in two separate RNA-seq library batches were used for differential RNA expression analysis (Extended Table 7-1) ...
-
bioRxiv - Genomics 2023Quote: ... using custom probes designed for targeted exome capture (TEC) and sequenced on paired-end mode (150 bp) on an Illumina NovaSeq 6000 platform (Illumina, San Diego, CA). Target resequencing was based on a custom probe design covering 1,609 nuclear genes with a 3.2M bp cumulative target size and reduced sequence redundancy (Milesi et al ...
-
bioRxiv - Genomics 2023Quote: ... All samples were sequenced in the MSU RTSF Genomics core with paired-end 150 bp reads on an HiSeq 6000 system (Illumina, San Diego, CA). Reads were quality and adapter trimmed using trimmomatic version 0.38 62 ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Samples were 2 × 150 bp paired-end sequenced on one lane each of a HiSeq X Ten instrument (Illumina, Inc., San Diego, CA). Samples for Luke and Nababiep were prepared by HudsonAlpha Institute for Biotechnology (Huntsville ...
-
bioRxiv - Immunology 2024Quote: ... TRB sequencing was performed on pools of libraries from 11 - 15 tumor or skin samples on the Illumina MiSeq platform using a v3 150-cycle kit (Illumina, San Diego, CA) in the FHCC Genomics Core Facility (Seattle ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... according to the manufacturer’s instructions and stored in 10 mM Tris buffer at pH 8 and -80 ⁰C until paired-end reads of 2 x 150 bp were sequenced on a NextSeq 500/550 (Illumina, San Diego, CA) at the University of Bristol Genomics Facility ...
-
bioRxiv - Genomics 2024Quote: ... Hi-C libraries for scaffolding were generated and sequenced by Arima Genomics (200.48 million PE 150-bp reads; Illumina NovaSeq; Arima Genomics, USA). To aid gene annotation ...
-
bioRxiv - Developmental Biology 2023Quote: ... Total RNA-Seq libraries were generated from 150-300 ng of total RNA using TruSeq Stranded Total RNA LT Sample Prep Kit with Ribo-Zero Gold (Illumina, San Diego, CA), according to manufacturer’s instructions ...
-
bioRxiv - Genomics 2023Quote: ... The libraries were sequenced at a target depth of 20,000 paired-end 150 bp reads per sample using a MiSeq machine (Illumina, San Diego, CA, USA). Reads were filtered by length <150 bp and using a maximum expected error threshold of 1.0 ...
-
bioRxiv - Plant Biology 2023Quote: ... Two µg of DNA were used to prepare 350-bp insert libraries for 150-bp paired-end sequencing (Novogene Biotech, Beijing, China) on an Illumina HiSeq 2500 system (Illumina, San Diego, USA) using standard Illumina protocols ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... multiplexed and sequenced as 150 bp paired-end reads using two lanes on an Illumina Hi-Seq 2000 (Illumina, San Diego, CA, USA) through Novogene (Beijing ...
-
bioRxiv - Immunology 2023Quote: ... Samples were randomly grouped and run with two libraries per sequencing run on three NextSeq High Output 150 cycle reagent kits (Illumina, San Diego, CA), with 1% PhiX ...
-
bioRxiv - Genetics 2022Quote: ... Total RNA-Seq libraries were generated from a minimum of 150-300 ng of total RNA using TruSeq Stranded Total RNA LT Sample Prep Kit with Ribo-Zero Gold (Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... A 150 bp paired-end library was generated according to the Illumina protocol and sequenced using Illumina HiSeq (Illumina, San Diego, California, USA). Potential nucleotide differences were validated using BRESEQ (Bowtie v2.3.4.1 ...
-
bioRxiv - Genomics 2022Quote: ... the purified pooled libraries at 1.5 pM were loaded onto an Illumina NextSeq 500/550 instrument with a Mid Output kit v2.5 (150 cycles) (Illumina, San Diego, CA, USA) using custom sequencing primers (both index and amplicon primers ...
-
bioRxiv - Microbiology 2022Quote: ... The constructed sequencing libraries were sequenced as paired-end reads (with 150–200 bp read length) on the Illumina NovaSeq 6000 system (Illumina; San Diego, CA). Raw reads were first processed through in-house scripts (Novogen ...
-
bioRxiv - Plant Biology 2023Quote: ... Generation of RNA-Seq libraries and 150-bp paired-end sequencing was carried out on an Illumina HiSeq 2500 (Illumina, San Diego, USA) or Novaseq6000 system by Novogene Biotech (Beijing ...
-
bioRxiv - Genomics 2022Quote: Libraries were sent to Novogene (Sacramento, CA) for sequencing on a single 2×150 lane of a HiSeq X Ten (Illumina, San Diego CA) and the raw sequencing reads were uploaded to the NCBI Sequence Short Read Archive (SRA ...
-
bioRxiv - Genomics 2023Quote: ... a library with an average insert size ∼150 bp was constructed and sequenced using the Illumina NovaSeq 6000 (Illumina, San Diego, CA, USA) platform ...
-
bioRxiv - Microbiology 2023Quote: ... the following RNA-derived SRA libraries from BioProjects PRJNA730226 and PRJNA730346 (Gao et al., 2021) were used: SRX10900611– SRX10900613 (150-bp Illumina reads from sporozoites), SRX10900614–SRX10900616 (150-bp Illumina reads from unsporulated oocysts) ...
-
bioRxiv - Molecular Biology 2023Quote: Two μg of DNA was used to prepare 350-bp-insert libraries for 150-bp paired-end sequencing (Novogene Biotech, Beijing, China) on an Illumina HiSeq 2500 system (Illumina, San Diego, USA) with standard Illumina protocols ...
-
bioRxiv - Genomics 2024Quote: ... Illumina short reads of 150 base pairs (bp) in paired-end (PE) format were sequenced using the Novaseq 6000 platform (Illumina, San Diego, CA) at Novaseq Inc ...
-
bioRxiv - Neuroscience 2024Quote: ... Paired-end sequencing of 150 bp was used for RNA sequencing on the Illumina NovaSeq 6000 platform (Illumina, Inc., San Diego, CA, USA). The GRCh38 (hg38 ...