Labshake search
Citations for Illumina :
951 - 1000 of 9045 citations for Prostaglandin E2 PGE2 Multi Format ELISA Kit 5 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were collected and subject to tagmentation at 37 °C for 30 minutes in adjusted tagmentation buffer (2x TD Tagment buffer + Digitonin 0.01% + 5 ul of TDE Tagment DNA enzyme from Illumina). Reaction was stopped with 0.2% SDS and DNA was collected using Qiaquick PCR purification columns and eluted in 10 μl 10 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2019Quote: ... We tagmented 5 ng of cDNA using 1 uL Nextera Tagment DNA Tn5 transposase (Illumina, San Diego, CA, 15027916) in a 10 uL tagmentation mix for 10 minutes at 55 °C.
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Evolutionary Biology 2020Quote: ... RNA input was normalized to 1µg and libraries were prepared using the TruSeq Stranded mRNA Sample Prep Kit (Illumina-Kit A). Libraries were again quantified ...
-
bioRxiv - Developmental Biology 2020Quote: ... The samples were then used to generate sequencing libraries with TruSeq RNA Sample Prep Kit v2 kit (Illumina, RS-122-2001) and paired-end sequenced (2×75 ...
-
bioRxiv - Bioengineering 2022Quote: ... The amount of genomic DNA was quantified by a Qubit dsDNA HS Kit (Thermo, Q33230) and prepared for Illumina analysis using the Illumina DNA prep kit (Illumina, 20018704). Illumina sequencing of the spirulina genome was performed on a MiSeq instrument using a MiSeq Reagent Kit v2 (Illumina ...
-
bioRxiv - Molecular Biology 2021Quote: ... Adaptor and index primers were added to the sheared DNA fragments using a next-generation sequencing library preparation kit (NEBNext Ultra DNA Library Prep Kit for Illumina; NEB) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2019Quote: Library was prepared with 700ng RNA of each sample using Truseq RNA sample prep kit v2 (stranded mRNA LT kit) according to the manufacturer’s instructions (Illumina Inc., USA) 70 ...
-
bioRxiv - Genetics 2019Quote: ... The libraries were amplified using the NPM mix (Nextera PCR Master Mix from Nextera DNA Library Prep Kit) and Index adapters i7 and i5 (Nextera Index Kit, Illumina, U.S), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2021Quote: ... Each Standard Flex library was constructed using all standard kit reagents from the Nextera DNA Flex Library Prep kit (Illumina, USA), following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... sequencing of the prepared library pools was performed using MiSeq high throughput kit (v3 kit, 600 cycles) with an Illumina MiSeq platform (Illumina, USA).
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing libraries were constructed from 1 ng of pre-amplified cDNA using DNA library preparation kit (TruePrep DNA Library Prep Kit V2 for Illumina, Vazyme). Libraries were sequenced on a HiSeq-PE150 ...
-
bioRxiv - Genomics 2022Quote: ... high-quality genomic DNA isolated from the young leaf samples of a short-grain aromatic rice variety Sonasal was used for constructing genomic DNA libraries using the SQK-LSK109 ligation kit (company name, country) and Illumina TruSeq DNA sample prep kit (Illumina, USA), respectively following the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: ... The RNA-seq libraries were prepared using a TruSeq RNA Sample Preparation Kit and Multiplexing Sample Preparation Oligonucleotide Kit (Illumina, USA). The libraries were sequenced on an Illumina GAIIx (Illumina ...
-
bioRxiv - Cell Biology 2019Quote: ... All RNA samples were depleted for ribosomal RNA before library construction using Ribo-Zero™ Gold Kit H/M/R Kit (Illumina). Hi-Seq run of three independent biological replicates was performed on Illumina HiSeq2500 ...
-
bioRxiv - Microbiology 2020Quote: ... Equimolar pooled library was sequenced on an Illumina MiSeq platform using 2×300bp reagent kit (Miseq reagent kit v3; Illumina Inc.) for paired-end sequencing ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... in the DNA Sequencing Section at the Okinawa Institute of Science and Technology Graduate University using HiSeq Rapid SBS Kit v2 kit (500 cycles, Illumina, USA) yielding 250-bp paired-end reads (Fig ...
-
bioRxiv - Cancer Biology 2023Quote: ... TruSeq® Stranded Total RNA LT Library Prep Kit or TruSeq Stranded mRNA Library Prep kit (Illumina, San Diego, CA, USA) was used for preparing Strand-specific whole transcriptome sequencing libraries by following the manufacturer’s procedure ...
-
bioRxiv - Genomics 2023Quote: ... Total genomic DNA was extracted using the QIAGEN DNAeasy Plant Mini Kit and the Illumina library was prepared using a TruSeq Nano DNA Library kit (Illumina, Inc.). Libraries with an insert size of ∼550 bp were sequenced for a read length of 100 bp in paired-end mode on a HiSeq 4000 at the iGE3 sequencing platform (Geneva ...
-
bioRxiv - Cell Biology 2023Quote: ... the first strand cDNA was synthesized using TruSeq stranded total RNA kit and TruSeq stranded mRNA kit (Illumina, San Diego, USA), followed by the second strand cDNA synthesis using dUTP ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The bisulfite-converted DNA samples were then processed for hybridization and staining using either the Illumina Infinium Human Methylation 450 BeadChip Kit or the Illumina Infinium MethylationEPIC BeadChip Kit (Illumina Inc.) according to the manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2023Quote: ... Single-end sequencing was performed using the library prep kit TruSeq and the sequencing kit NovaSeq6000 SP Flowcell 100 cycles (Illumina, Inc.) for Mus musculus (Ensembl.GRCm38.82) ...
-
bioRxiv - Physiology 2023Quote: ... 500 ng total RNA from each sample were used to make library according to the product guide of stranded mRNA library kit (E4720L; NEBNext Ultra™ Directional RNA Library Prep Kit for Illumina). In short ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Molecular Biology 2021Quote: ... and ribosomal RNA was removed using the Ribo-Zero™ Magnetic Core Kit and Ribo-Zero™ rRNA Removal kit (Illumina, USA), according to the manufacturers’ protocols ...
-
bioRxiv - Microbiology 2019Quote: ... DNA libraries were prepared for equimolar-pooling using Nextera DNA Library Preparation Kit and Nextera Index Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... Multiple shotgun genomic libraries were prepared using Illumina TruSeq DNA PCR-free library preparation kit and Nextera XT sample preparation kit (Illumina Inc., USA) as per the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Genomic DNA libraries were created using the Nextera XT library preparation kit and Nextera XT index kit v2 (Illumina, San Diego, CA) and sequencing was performed using 2×250-bp dual-index runs on an Illumina MiSeq at the University of Minnesota Mid-Central Research and Outreach Center (Willmar ...
-
bioRxiv - Pathology 2022Quote: ... The RNA of the extracted sample was used to build a cDNA library by a reverse transcription kit based on the manufacturer’s instruction (NEBNext® Ultra™ RNA Library prep Kit for Illumina®).
-
bioRxiv - Microbiology 2021Quote: ... The QIAseq FastSelect 5S/16S/23S rRNA removal kit was used to treat samples prior to library prep with the TruSeq Stranded Total RNA Library Prep Kit (Illumina, CA, USA). Sequencing was conducted on the Illumina HiSeq 4000 at 50 bp single-end reads.
-
bioRxiv - Bioengineering 2022Quote: Total RNA was extracted from iPSC-CM monolayers using a Qiagen RNeasy Micro kit and prepared for sequencing at 100 ng with a Stranded Total RNA Prep kit (Illumina Inc., USA), and bulk-sequenced at the Princess Margaret Genomics Center (Toronto ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal depleted RNA-seq libraries were prepared using the TruSeq® Stranded Total RNA Library Prep Kit Human/Mouse/Rat kit (Illumina, 20020596) following manufacturer’s instructions ...