Labshake search
Citations for Illumina :
51 - 100 of 1391 citations for rno mir 542 5p RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... DNA was PCR-amplified with TruSeq dual indexing primers (Illumina) to generate Illumina compatible libraries ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... followed by tailed-PCR using Nextera XT Index Primers (Illumina) (S1B Fig) ...
-
bioRxiv - Cell Biology 2020Quote: ... Secondary PCR was performed using Nextra XT index primers (Illumina). The secondary PCR condition was 95 °C (20 sec) ...
-
bioRxiv - Microbiology 2023Quote: ... followed by PCR amplification using TruSeq-designed primers from Illumina guidelines ...
-
bioRxiv - Immunology 2019Quote: ... PCR products were indexed by Nextera XT index Kit Set A and Set D (Illumina; FC-131– 2001 and FC-131–2004) according to Illumina’s protocol for 16S metagenomic library preparation ...
-
bioRxiv - Microbiology 2023Quote: ... Both primer sets were tagged with 10 bp oligonucleotides for multiplexing Nextera™ DNA Sample Prep Kit (Illumina®-Compatible ...
-
bioRxiv - Microbiology 2019Quote: ... qPCRs were performed in an Eco RT-PCR system (Illumina). Relative quantification of gene expression was determined by the 2−ΔΔCt method [25] applied with software conforming to minimum information for publication of RT-qPCR experiments (MIQE ...
-
bioRxiv - Genomics 2020Quote: ... a PCR titration was performed prior to the production PCR (using Illumina primers PE1.0 and PE2.0). Primers were separated from the final library by size selection with AMpure XP (1:1 ratio ...
-
bioRxiv - Microbiology 2020Quote: ... and TruSeq Index PCR Primer barcodes (Illumina, San Diego, CA, USA) were used to prepare and index each individual library ...
-
bioRxiv - Immunology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(Stoeckius et al. ...
-
Naked Mole-Rat Hematopoietic Stem and Progenitors are Highly Quiescent with an Inherent Myeloid BiasbioRxiv - Cell Biology 2021Quote: ... and indexed TruSeq Small RNA PCR primers (Illumina, San Diego, CA) as specified(13) ...
-
bioRxiv - Systems Biology 2021Quote: ... and libraries were amplified by PCR with barcoded Nextera primers (Illumina) using 2X NEBNext High-Fidelity PCR Master Mix (NEB) ...
-
bioRxiv - Cancer Biology 2022Quote: ... purified PCR products were amplified using indexed adapter primers from Illumina to generate barcoded amplicons and NEBNext Ultra II Q5 Master Mix (NEB ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCRs were performed using index primers (NEBNext multiplex oligos for Illumina, set 1 ...
-
bioRxiv - Molecular Biology 2022Quote: Cell lysate was PCR amplified with genomic primers flanked by Illumina adaptor overhang to generate approximately 300 base products ...
-
bioRxiv - Molecular Biology 2023Quote: ... Library fragments were amplified using standard PCR and Nextera primers (Illumina) by adding 25 μl of 2x NEBnext master mix ...
-
bioRxiv - Genomics 2019Quote: ... 1μL SR RT Primer and following the manufacturers protocol (NEB small RNA for Illumina library prep); “Hybridize the reverse transcription primer” followed by “ligate 5’ SR adaptor…” ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Neuroscience 2023Quote: ... Linker-ligated RNA was then incubated with RT Primer (TruSeq Small RNA Library Prep Kit, Illumina) and reverse transcription was performed with Superscript III RT (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Immunology 2022Quote: ... cDNA libraries were amplified 12 cycles of PCR with Terra PCR Direct polymerase Mix in the presence of i5 or i7 PCR primers (Illumina) to add sample specific indexes ...
-
bioRxiv - Genomics 2021Quote: ... Illumina adapter ligation and PCR The TruSeq DNA LT kit Set A (Illumina, #15041757) was used ...
-
bioRxiv - Immunology 2021Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Neuroscience 2022Quote: ... and finally converted into DNA libraries using custom rpi primers (RNA PCR Primer Index) adapted from the Truseq Small RNA kit (Illumina)106 ...
-
bioRxiv - Cancer Biology 2022Quote: ... and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics) and a Nextera i7 reverse primer (Illumina). For the HTO-containing fraction ...
-
bioRxiv - Microbiology 2019Quote: ... containing 5µL of each index primer (Nextera XT Index kit v2 set A, B and D; Illumina, San Diego, CA), 10ul of purified PCR products (0-20ng/µL ...
-
bioRxiv - Molecular Biology 2022Quote: ... MCF7 and BT-474 libraries were independently amplified with index primers N7xx and S5xx of Nextera XT Index Kit v2 Set A (FC-131-2001, Illumina) and Nextera XT Index Kit v2 Set B (FC-131-2002 ...
-
bioRxiv - Developmental Biology 2022Quote: ... Bacterial 16S rRNA amplicons were constructed via amplification of the V4 region of the 16S rRNA gene with the universal primer set (U515F/806R) and flanked by Illumina standard adapter sequences as in a method previously described elsewhere33,34 ...
-
bioRxiv - Microbiology 2023Quote: ... One microliter of each eluted sample was used in polymerase chain reaction amplification of the variable region 4 of bacterial and archaeal 16S ribosomal RNA genes with barcoding primer set 515/806 based on the original Earth Microbiome Project protocol (Caporaso et al. 2011; “16S Illumina Amplicon ProtocolL ...
-
bioRxiv - Microbiology 2023Quote: ... amplified with the prokaryotic universal primer sets encoding F515/R806 47 were sequenced on a NovaSeq 6000 platform (Illumina, CA) at Novogene Co ...
-
bioRxiv - Microbiology 2024Quote: ... Variant type was confirmed in a subset of samples with available nasopharyngeal swabs by SARS-CoV-2 complete genome next-generation sequencing using Artic v5.3.2 (IDT, Coralville, IA) and Artic v4.1 primer sets (Illumina, San Diego, CA).
-
bioRxiv - Immunology 2020Quote: ... A second PCR was performed with Nextera® XT Index Kit v2 Set A (Illumina) to complete the adapter and add a unique sample-specific barcodes ...
-
bioRxiv - Plant Biology 2021Quote: ... RT-qPCR was conducted using Eco Real-Time PCR (Illumina, CA, USA). The PCR mixture included 10 µl 2× Realtime PCR mix (Biofact ...
-
bioRxiv - Genetics 2019Quote: ... An indexing PCR was performed next using Nextera XT index kit primers (Illumina) and NEBNext High-Fidelity 2X PCR Master Mix (NEB ...
-
bioRxiv - Immunology 2022Quote: ... tagmented cDNA was amplified with Nextera PCR Mastermix containing Nextera i5 primer (Illumina), and custom i7 primer mix ...
-
bioRxiv - Neuroscience 2022Quote: ... 9-cycle PCR were performed using indexed primers from Nextera Index Kit (Illumina) and KAPA HiFi HotStart ReadyMix (KAPA Biosystems) ...
-
bioRxiv - Microbiology 2022Quote: ... and submitted to an additional 10 rounds of PCR with indexing primers (Illumina). The resulting libraries were pooled by volume with specimens at 100x the positive controls ...
-
bioRxiv - Molecular Biology 2023Quote: ... First-round PCR primers contained adapter sequence for DNA/RNA UD Indexes (Illumina). The second round of PCR and pooling of samples was performed according to the Illumina Nextera DNA library prep guide ...
-
bioRxiv - Microbiology 2023Quote: ... Secondary PCR was performed with forward and reverse primer sequences designated by Illumina. The thermal condition was set to be the same as the first PCR but for 8 cycles ...
-
bioRxiv - Molecular Biology 2022Quote: ... and 1.25 μM i5 and i7 PCR primers (Nextera® Index Kit (Illumina)) with the following PCR amplification conditions ...
-
bioRxiv - Microbiology 2023Quote: ... Reverse primers contained i7 indexes from the TruSeq DNA PCR Free kit (Illumina). PCR reactions were run on agarose gels to verify amplification ...
-
bioRxiv - Microbiology 2022Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermalcycler with the following program ...
-
bioRxiv - Genetics 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with partial adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermal cycler with the following program ...
-
bioRxiv - Systems Biology 2023Quote: ... in a 100 µl reaction with 2 µl gDNA (∼100 ng) and primers oJMP697 and oJMP698 (nested primers with adapters for index PCR with Illumina TruSeq adapter) according to the manufacturer’s protocol using a BioRad C1000 thermocycler with the following program ...
-
bioRxiv - Synthetic Biology 2024Quote: ... Extracted DNA was PCR amplified with a forward primer binding to the end of the leader sequence (PCR1 Fwd primer with Illumina adapter overhang) and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang) ...
-
bioRxiv - Cell Biology 2022Quote: ... 10μl of the tagmented chromatin was mixed with 2.5μl of Nextera PCR primer cocktail and 7.5μl of Nextera PCR master-mix (Illumina FC-121-1030) in low-binding PCR tubes ...
-
bioRxiv - Microbiology 2019Quote: ... set A (Illumina) which consists in ...
-
bioRxiv - Neuroscience 2021Quote: ... Universal adapters were ligated followed by 10 cycles of PCR using Illumina PCR Primer Cocktail and Phusion DNA polymerase from Illumina. Subsequent library purification with Agencourt AMPure XP beads was validated with Agilent Bioanalyzer 2100 ...
-
bioRxiv - Microbiology 2021Quote: ... 50 ng of each amplicon was dual indexed in a 5-cycle PCR reaction using the PCR module and indexed primers from the Nextera kit (Illumina). Resulting libraries were purified on AMPure XP magnetic beads (Beckman Coulter ...