Labshake search
Citations for Illumina :
51 - 100 of 1586 citations for L Valine 13C5 95 97%; 15N 96 99%; 2 3 D2 97%+ since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2022Quote: ... and sequencing was performed on NextSeq500 (single-end 96 bp; Illumina). Differential expression analysis on voom normalized51 gene expression values were performed using limma eBayes52,53 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and Illumina UD 96 index kit (Illumina, San Diego, CA, USA) to add barcodes ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... the two libraries then were pooled with 48 libraries of other projects and subsequently sequenced on 0.09% (L. virgatum) and 0.08% (L. vulgare) of one lane on an Illumina MiSeq system (Illumina, San Diego, California, USA) at the Department of Biochemistry I at the University of Regensburg ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina) were used for construction of complementary DNA libraries and the complementary DNA libraries were sequenced on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... 2 (Illumina) and the HiSeq Rapid SBS Kit v2-HS (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... 2 (Illumina) for the sequencing.
-
bioRxiv - Immunology 2023Quote: ... 2 (Illumina) was the primer source ...
-
bioRxiv - Microbiology 2023Quote: ... and we typically pooled 96 sequencing libraries on a Next-seq (Illumina) for sequencing.
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2019Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Each individual received a unique barcode before multiplexing 96 individuals per lane (Illumina HiSeq 2000 ...
-
Tryptophan Metabolites And Their Predicted Microbial Sources In Fecal Samples Of Healthy IndividualsbioRxiv - Microbiology 2024Quote: ... A set of 96 Unique dual index barcodes (Illumina TruSeq UD Indexes, # 20022370) were utilized to barcode samples ...
-
bioRxiv - Molecular Biology 2019Quote: ... 10% (vol/vol) dimethylformamide) and 2.5 ?l of TDE1 enzyme (Illumina). Transposed fragments were purified using a MinElute PCR purification kit (QIAGEN) ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Genomics 2020Quote: Equimolar libraries from each 96 well plate were pools and sequenced with NextSeq500 (Illumina) High Output ...
-
bioRxiv - Neuroscience 2019Quote: Illumina TruSeq Stranded mRNA sample preparation kit with 96 dual indexes (Illumina, CA, USA) was used to prepare RNA libraries for sequencing ...
-
bioRxiv - Cell Biology 2023Quote: ... and Nextera® XT Index Kit (96 indexes, 384 samples) (Illumina, FC-131-1002) according to the manufacturer protocol (with 2.5 x volume reduction in all reactions) ...
-
bioRxiv - Neuroscience 2019Quote: ... Index 2: 8 cycles) across 2 runs on a NextSeq 500 (Illumina) with an average read depth across biological replicates of 8,815 reads per cell.
-
bioRxiv - Genomics 2020Quote: ... 300×2 bp or 150×2 bp (Illumina, Inc., San Diego, CA).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina, CA, USA). The two types of libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl transposase (Illumina), 10.5 μl nuclease-free water and 0.01% NP-40 ...
-
bioRxiv - Immunology 2021Quote: ... Group 2 (France, Illumina), Group 3 (North America ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, CA, USA). ASVs were inferred using DADA2 v ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 from Illumina libraries.
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Bioengineering 2023Quote: ... Nextera XT Index Kits (96 indexes, 384 samples) were purchased from Illumina (FC-131-1002). Axygen AxyPrep Mag PCR Clean-up Kits were purchased from Thermo Fisher Scientific (MAGPCRCL) ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...