Labshake search
Citations for Illumina :
51 - 100 of 8969 citations for Human Aflatoxin B1 Aldehyde Reductase Member 3 AKR7A3 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng RNA was prepared with a commercially available kit according to the manufacturer’s instruction (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina HiSeq2500 in 50bp single-read mode.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... cDNA was prepared using the manufacturers protocol (Chromium Single Cell 3’ reagent kits kit v3, 10x Genomics) and sequenced on a Novaseq 6000 instrument (Illumina). After sample processing and quality control analysis ...
-
bioRxiv - Neuroscience 2023Quote: ... Ribosomal depleted RNA-seq libraries were prepared using the TruSeq® Stranded Total RNA Library Prep Kit Human/Mouse/Rat kit (Illumina, 20020596) following manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2019Quote: ... Ribosomal RNA was depleted using the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and the RNA-seq library was prepared using TruSeq Stranded mRNA Library Prep Kit (Illumina ...
-
bioRxiv - Zoology 2021Quote: ... the ribosomal RNA was removed using the Ribo-Zero-Gold (Human–Mouse–Rat) Kit (Illumina, USA) and the Ribo-Zero-Gold (Epidemiology ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were prepared using the TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat kit (Illumina) including a ribosomal RNA depletion step and sequenced on the Illumina HiSeq2500 platform (50 nt single-end reads).
-
bioRxiv - Microbiology 2022Quote: ... after first removing the host rRNA with a Ribo-Zero-Gold (Human–Mouse–Rat) kit (Illumina). Each library was sequenced as 100-bp paired-ends on the Novaseq 6000 S4 platform (Illumina).
-
Coding and non-coding drivers of mantle cell lymphoma identified through exome and genome sequencingbioRxiv - Genomics 2019Quote: ... we used the Agilent SureSelect Human All Exon kits for library preparation and HiSeq2000 instruments (Illumina) for sequencing ...
-
bioRxiv - Pathology 2021Quote: ... Ribosomal RNA depletion was carried out solely using the RiboZero Gold Human/Mouse/Rat kit (Illumina). Adapter sequences were based on the TruSeq small RNA sequences (Illumina ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) for human and mouse samples and with Caenorhabditis elegans Ribo-Seq riboPOOLs (siTOOLs Biotech ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was performed with the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... rRNA depletion was conducted by the Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, accompanied by TruSeq Stranded Total RNA Kit) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Genome-wide DNA methylation was analysed on 850000 CpGs with the Infinium Human MethylationEPIC Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Genomics 2024Quote: Human islet RNA-seq libraries were prepared from total RNA using the stranded TruSeq kit (Illumina). ERCC Mix 1 or Mix 2 spike-ins were randomly added to each sample (Thermo Fisher ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Molecular Biology 2021Quote: ... ribosomal RNAs were removed by a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina, RZG1224). Then ...
-
bioRxiv - Genomics 2020Quote: ... Total RNA was depleted from ribosomal RNA using Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat, Illumina) followed by cDNA library preparation as described below.
-
bioRxiv - Neuroscience 2022Quote: ... All samples were depleted of ribosomal RNA using the Ribo-Zero Gold (Human/Mouse/Rat) Kit (Illumina) (replicates 1-3 and cycloheximide treated ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were prepared using the Agilent SureSelect XT Human All Exon + UTR (v8) kit followed by Illumina NovaSeq 6000 150 cycle paired end sequencing ...
-
bioRxiv - Microbiology 2021Quote: ... Host ribosomal depletion was performed using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Paired-end transcriptome sequencing was generated on the HiSeq2500 platform (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... Total RNA samples were treated with a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina) and used for RNA-Seq library preparation using an Illumina TruSeq Stranded Total RNA Library Prep Kit (Illumina ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 μg of the product was processed using the TruSeq RNA Sample Preparation Kit (Illumina). Purification of mRNA was performed using polyT oligo-attached magnetic beads ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Cancer Biology 2019Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Neuroscience 2021Quote: ... 2 μg of total RNA were treated with the Ribo-Zero rRNA Removal Kit (Human/Mouse/Rat; Illumina). Depleted RNA was precipitated 1h at −80°C in three volumes of ethanol plus 1 μg of glycogen ...
-
bioRxiv - Molecular Biology 2019Quote: ... Total RNA was depleted of ribosomal RNA using Ribo-Zero rRNA Removal Kit (Epicentre/Illumina, Human/Mouse/Rat) and library preparation was completed using NEBNext® Ultra Directional RNA Library Prep Kit for Illumina® (New England Biolabs) ...
-
bioRxiv - Neuroscience 2021Quote: Analysis of pluripotency gene expression profile was performed using the Human-HT-12-v4 expression BeadChip Kit (Illumina) and subsequent Pluritest analysis ...
-
bioRxiv - Molecular Biology 2021Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA was removed from total RNA using the Ribo Zero Gold for human/mouse/rat kit (Illumina). Using the TruSeq RNA Sample Library Preparation v.2 kit (Illumina) ...
-
bioRxiv - Genomics 2023Quote: ... and stranded total RNA libraries were prepared using the TruSeq Stranded Total RNA Human/Mouse/Rat kit (Illumina), following manufacturer’s instructions.
-
bioRxiv - Plant Biology 2020Quote: ... Libraries were pooled and sequenced with 3 runs on the MiSeq using the reagent kit V2 (Illumina).
-
bioRxiv - Neuroscience 2024Quote: ... 3 brain regions per mouse using the TruSeq stranded mRNA LT kit (Cat# RS-122-2101, Illumina). These synthetic RNAs cover a range of concentrations ...
-
bioRxiv - Molecular Biology 2020Quote: ... Human/Mouse/Rat (Illumina, discontinued), and fragmented by incubating with PNK buffer (NEB ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA library construction using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human (Illumina #RS-122-2201) and sequencing on an Illumina NovaSeq6000 platform was performed by Macrogen (Tokyo ...
-
bioRxiv - Genomics 2019Quote: ... followed by the removal of ribosomal RNA using a Ribo-Zero Gold rRNA Removal Kit (Human/Mouse/Rat) (Illumina). Strand-specific sequencing libraries were prepared using a NEBNext Ultra II Directional RNA Library Prep Kit for Illumina (NEB) ...
-
bioRxiv - Genomics 2019Quote: ... RNA sequencing libraries were made using the TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) according to manufacturer instructions ...