Labshake search
Citations for Illumina :
51 - 100 of 299 citations for GPN loop GTPase 3 GPN3 Antibody Biotin since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Molecular Biology 2022Quote: ... and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7), with both containing 8N barcodes for multiplexing.
-
bioRxiv - Cancer Biology 2022Quote: ... All of the 3′ and 5′ flowcells were demultiplexed with bcl2fastq (Illumina). FASTQ files were processed with Cell Ranger v7.0.1 (10x Genomics) ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Immunology 2024Quote: ... and the SureCellTM WTA 3’ Library Prep Kit (Illumina, San Diego, CA). Magnetically enriched NK cells from malaria-naïve subjects were treated with cytokines IL-15 ...
-
bioRxiv - Plant Biology 2024Quote: ... The 3’mRNA-sequencing was performed in a NovaSeq X (Illumina Platform) by Seqplexing (Paterna ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA expression (RNA-Seq level 3 data) and DNA methylation (Illumina HumanMethylation450 array) data of 33 types of cancers (n=10,528 ...
-
bioRxiv - Genomics 2021Quote: ... Lab 3 sequenced DNA on a NextSeq 550 (Illumina, San Diego, CA, USA), paired-end 2×75 bp ...
-
bioRxiv - Molecular Biology 2020Quote: Create CSV files listing of all 3 sets of barcodes (Illumina, plate, well)
-
bioRxiv - Genomics 2023Quote: ... and combined with PhiX control (v.3, Illumina Inc, San Diego, CA, USA) at a final concentration of 1% ...
-
bioRxiv - Neuroscience 2023Quote: ... cDNA libraries were prepared using a 3′-Tag-RNA-Seq library kit (Illumina). Sequencing was performed using one lane of a Hi-Seq 4000 platform with pair-end 40 bp reads ...
-
bioRxiv - Immunology 2024Quote: ... using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with AMPpure XP beads cleanup ...
-
bioRxiv - Plant Biology 2024Quote: ... 3’-end adenylation and methylated adaptor ligation using Illumina TruSeq DNA kit (Illumina). Then bisulfite conversion was performed using a Zymo EZ DNA Methylation-Lightning kit (Zymo Research) ...
-
bioRxiv - Neuroscience 2021Quote: ... The blunt-ended double-stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Cell Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters (Illumina) were ligated ...
-
bioRxiv - Genomics 2021Quote: For each sample sequenced in 3 separate experiments (CoronaHiT-ONT, CoronaHiT-Illumina, ARTIC-ONT), a phylogeny was generated from all of the consensus genomes (n=216 for the routine samples and n=132 for the rapid response samples ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing was performed using TruSeq 3000 4000 SBS Kit v.3 (Illumina) on the HiSeq 4000 platform (11 ...
-
bioRxiv - Molecular Biology 2023Quote: ... which was prepared with the QuantSeq 3’ mRNA-Seq Library Prep Kit from Illumina following the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... and day 3 RNA using the TruSeq Stranded mRNA Library Prep Kit (Illumina 20020594) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Cell Biology 2021Quote: ... and 3 cycles of PCR for incorporation of unique dual indices (NEBNext multiplex oligos for Illumina) to the final libraries ...
-
bioRxiv - Cancer Biology 2021Quote: ... Both libraries were prepared using the QuantSeq 3′ mRNA-Seq Library Prep Kit FWD from Illumina, following the standard protocol ...
-
Three Distinct Transcriptional Profiles of Monocytes Associate with Disease Activity in SSc PatientsbioRxiv - Genomics 2022Quote: ... Both full-length and 3’ RNA- seq libraries were sequenced on a NextSeq 500 instrument (Illumina) with 5-10 x 106 aligned reads per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... We diluted the final library to 3 nM concentration and used a HiSeq PE150 sequencer (Illumina) to perform the sequencing.
-
bioRxiv - Genomics 2021Quote: ... and dual-indexed 3’ digital gene expression (DGE) sequencing libraries were prepared using Nextera XT (Illumina). Libraries were sequenced on a NovaseqS4 or NovaseqS2 with a paired end read structure (R1 ...
-
bioRxiv - Microbiology 2020Quote: ... The MiSeq Reagent Kit v.3 (2 x 300 bp) (Illumina Inc., San Diego, California USA) was used for sequencing according to manufacturer’s recommendations.
-
bioRxiv - Genetics 2020Quote: ... 3 groups in total) and constructed using the Illumina TruSeq Stranded Small RNA Sequencing kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... and 3 μg of the product was processed using the TruSeq RNA Sample Preparation Kit (Illumina). Purification of mRNA was performed using polyT oligo-attached magnetic beads ...
-
bioRxiv - Microbiology 2023Quote: ... 4 μl of the 3’-5’-adapter-ligated RNA was mixed with barcoded RT primers (Illumina) and cDNA synthesis was performed using SuperScript™ II Reverse Transcriptase (Invitrogen ...
-
bioRxiv - Genomics 2023Quote: scRNA-seq library preparation was performed using 10x Genomics Chromium 3’ single cell library protocol (Illumina) according to the manufacturer’s instructions ...