Labshake search
Citations for Illumina :
51 - 100 of 1946 citations for Benzyl 2 3 4 5 6 d5 dimethyltetradecylammonium Bromide since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Systems Biology 2023Quote: ... 200-500 ng DNA was used for genotyping using the Infinium Omni2.5-8v1-4 and the Infinium Omni2.5-8v1-5 Genotyping BeadChip (Illumina) at the UCSD IGM core ...
-
bioRxiv - Molecular Biology 2020Quote: ... Small RNA-seq libraries for 2–4 biological samples were sequenced together using a NextSeq 500 (Illumina) to obtain 75 nt ...
-
bioRxiv - Developmental Biology 2022Quote: ... 75bp single end sequencing was carried out on 4-6 libraries / genotype using Illumina NextSeq500 High output mode and v2.5 chemistry (Illumina Protocol 15046563 v02, Mar 2016) to collect >25M reads per sample.
-
bioRxiv - Cancer Biology 2022Quote: ... using primers DCF01 5’-CTTGTGGAAAGGACGAAACACCG-3’ and DCR03 5’-CCTAGGAACAGCGGTTTAAAAAAGC-3’ and subjected to single-end 75 bp (SE75) high-throughput sequencing using a NextSeq550 (Illumina).
-
bioRxiv - Developmental Biology 2020Quote: ... and two different mate-pair libraries (3 kb and 5 kb) were prepared with a Nextera Mate Pair Library Prep Kit (Illumina). Sequencing libraries were run on the Illumina Hiseq 2500 sequencer with a read length of 150 bp ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... The rRNA-depleted samples were used for TruSeq Stranded RNA Sample Prep kit to produce 5′ to 3′ strand-specific cDNA libraries (Illumina). A TruSeq SBS sequencing kit version 3 (Illumina ...
-
bioRxiv - Cell Biology 2023Quote: ... Illumina sequencing libraries were indexed with unique 5’ and 3’ barcode combinations (up to 384 cells) using the Nextera XT DNA library preparation kit (Illumina). Libraries were pooled and size-selected with 0.9X AmpPure XP beads ...
-
bioRxiv - Microbiology 2023Quote: ... 3-5 µg of each sample was treated with Ribozero® rRNA Removal Kit according to the manufacturer’s instructions (Illumina, USA ...
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Microbiology 2024Quote: ... The RNA was dephosphorylated in 3’ and then phosphorylated in 5’ to generate cDNA libraries using the NebNext Small RNA Sample Prep kit with 3’ sRNA Adapter (Illumina) according to the manufacturer’s protocol with 12 cycles of PCR amplification in the last step followed by DNA purification with Monarch PCR DNA cleanup kit (NEB) ...
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Cell Biology 2024Quote: ... After 2-3 passages in complete DMEM with 10% FBS gDNA was extracted to confirm the genotype by Illumina amplicon sequencing and live cell microscopy was performed.
-
bioRxiv - Immunology 2023Quote: ... 3 (Illumina).
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
A New Gene Set Identifies Senescent Cells and Predicts Senescence-Associated Pathways Across TissuesbioRxiv - Cell Biology 2021Quote: ... and 2-5 cm inferior to the navel.24,38 Sequencing was performed on a HiSeq2000 (Illumina®), fastq files were mapped to the human reference genome hg19 ...
-
bioRxiv - Molecular Biology 2022Quote: ... followed by library construction using non-stranded (Replicate 1) or stranded (Replicates 2 and 3) TruSeq mRNA Library Prep Kit (Illumina). The resulting libraries were sequenced on Hiseq4000.
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were constructed with version 2 (stage 16a) or version 3 (stage15 a/b) chemistry and sequenced on a single HiSeqX (Illumina) lane to generate 400-450 million paired-end 150 bp reads (Supplementary Table 4).
-
bioRxiv - Microbiology 2020Quote: ... The obtained partitions were further processed using the Chromium Single Cell 3’ Reagent Kit (version 2, 10x Genomics) to generate Nextera XT sequencing libraries that were sequenced on a HiSeq3000 (Illumina), using a single flow cell lane for each library.
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Systems Biology 2024Quote: ... Illumina BeadArrays (mouse WG-6, Illumina) were used to profile the transcriptome of 33 independent EpiSC samples ...
-
bioRxiv - Systems Biology 2024Quote: ... in two growth media conditions (CMAF and Basal)—were profiled by Illumina BeadArrays (mouse WG-6 v2, Illumina). Poor quality profiles were removed ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Molecular Biology 2024Quote: ... purified and ligated to 3′ and 5′ RNA adapters derived from TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA). Small RNA libraries were created using TruSeq Small RNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Genomics 2024Quote: ... we further pooled the hybrid selection into 3 “super pools.” 2) The hybrid selected libraries were sequenced on a NovaSeq 6000 (Illumina, 20012850) with a S1 Reagent Kit v1.5 (200 cycles ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Neuroscience 2021Quote: ... a forward primer 5′-CTT TCC CTA CAC GAC GCT CTT CCG ATC TAC GGR AGG CAG CAG-3 (28-nt Illumina adapter (in bold) followed the 14 nt broad range bacterial primer 343F ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA fragments were end-paired and phosphorylated at the 5’ end and successively adenylated at the 3’ end (following Illumina paired-end protocols), and the libraries ligated to the precapture adaptor were amplified and indexed via PCR ...
-
bioRxiv - Microbiology 2021Quote: ... 6) merged triplicates for DC3000 − (Illumina only), 7 ...
-
bioRxiv - Microbiology 2022Quote: ... A 2.5 kb jumping library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced at the Broad Institute Genomics Platform on an Illumina HiSeq 2000 system to generate paired 101-base reads ...
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Genomics 2024Quote: ... A 2.5-kb ‘jumping’ library was prepared using the 2-to-5-kb insert Illumina Mate-pair library prep kit (V2; Illumina). These libraries were sequenced on an Illumina HiSeq 2000 ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pooled libraries with unique 5′ and 3′ index adapter pairs were sequenced on an NextSeq 2000 P3 flow cell (Illumina®: San Diego, CA) to generate 66M (±12M ...
-
bioRxiv - Microbiology 2021Quote: ... Goe13 and lysogens and sequenced with the MiSeq system and reagent kit V.3 (2 x 300 bp) (Illumina, San Diego, CA, USA) and the NovaSeq system (2x 150bp ...
-
bioRxiv - Cancer Biology 2020Quote: ... and hybridized to BeadChip Array MouseWG-6 (Illumina). Bead chips were scanned with an Illumina BeadArray Reader ...
-
bioRxiv - Systems Biology 2024Quote: ... and hybridized on mouseWG-6 v2 BeadArrays (Illumina). Slides were scanned using an iScan (Illumina SY-101- 1001 ...
-
bioRxiv - Genomics 2022Quote: ... spun at 300G for 12 min at 4 ºC and resuspended in 20 uL transposition mix: 1X TD buffer and 2 uL of TDE1 (Illumina #FC-121-1030), 0.01% Digitonin in DMSO ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...