Labshake search
Citations for Illumina :
51 - 100 of 800 citations for 8 3 5 DIMETHYL 4 METHOXYPHENYL 8 OXOOCTANOIC ACID since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2020Quote: ... Cohort 2 gene expression data were measured using a Human Ref-8 BeadChip array (Illumina, Inc) with ∼22k probes ...
-
bioRxiv - Genomics 2022Quote: ... Genotyping was carried out using the HumanOmniExpressExome-8 v1.0 or v1.2 BeadChips with Infinium chemistry (Illumina). Genotypes were processed using the GenomeStudio Analysis software v2011.1 (Illumina ...
-
bioRxiv - Genetics 2019Quote: Genome-wide multipoint linkage analysis was performed using the HumanOmniZhongHua-8 BeadChip (Illumina, San Diego, USA) and based on genotypes of 6301 Tag SNPs with an averaged 0.5cM resolution ...
-
bioRxiv - Developmental Biology 2020Quote: ... and subsequently another 8-12 PCR cycles with the specific primers (Illumina Nextera XT index kit); samples were cleaned with PCR purification kit (Qiagen ...
-
bioRxiv - Genomics 2022Quote: ... DNA was genotyped at the Children’s Hospital of Philadelphia’s Center for Applied Genomics using the Infinium Omni2.5-8 v1.3 BeadChip (Illumina) on an iScan System instrument (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... Biotinylated cDNA (750 ng) was hybridized at 48°C to MouseRef-8 v2 expression beadchips (Illumina) for 16 h before washing and analyzing according to the manufacturer’s directions ...
-
bioRxiv - Cell Biology 2023Quote: ... 8 µL of 100 pM pooled libraries were loaded into lanes of a HiSeq 4000 (Illumina). At least 30M reads per library were generated ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2020Quote: ... was performed with ~8 million reads / sample in single-end mode on the NextSeq 500 platform (Illumina) with the High Output Kit v2.5 (75 Cycles).
-
bioRxiv - Microbiology 2021Quote: ... pooled and sequenced using two lanes of HiSeqX (Illumina; 150bp paired-end; read length 28*8*91). Two biological replicates of each L ...
-
bioRxiv - Genetics 2022Quote: ... Individual sequencing barcodes were added to each sample by amplifying the 20 μL elution in a 50 μL Q5 NEBNext reaction with 0.5 uM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex) for sample demultiplexing post-sequencing ...
-
bioRxiv - Cancer Biology 2019Quote: ... gene expression analysis was performed using Illumina’s Mouse Ref 8 Beadchip v1 (Illumina Inc, San Diego, CA). These datasets have been deposited in GEO as accession entry GSE22520 and described in Supplemental Table 1c ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Samples with a RIN >8 was outsourced to Novogene for library construction and sequencing (Illumina Platform (PE150)) with 20 M raw reads/sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Genetics 2021Quote: ... 1 µg of high quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation of high-quality RNA (RIN >8) was performed using the TruSeq RNA sample preparation kit (Illumina). Raw sequencing data was aligned to human genome B38 ...
-
bioRxiv - Developmental Biology 2019Quote: ... with RIN values > 8 were subjected to Automated TruSeq stranded total RNA with RiboZero Gold library preparation (Illumina). Single-end 50 bp reads were generated with HiSeq2500 ...
-
bioRxiv - Genomics 2020Quote: ... Genome-wide genotyping of 200 ng genomic DNA from the remaining 207 patients was carried out using Infinium HumanOmni2.5-8 v1.2 BeadChip microarrays (Illumina). After completion of the assay ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Developmental Biology 2022Quote: Transposed DNA fragments were purified using the Qiagen MinElute kit and amplified 6-8 cycles using the Nextera (Illumina) PCR primers ...
-
bioRxiv - Neuroscience 2020Quote: ... and sequenced them using PE100 reads and 2 × 8 bp index reads on a Novaseq 6000 Sequencing System (Illumina) aiming for 1 million reads per cell.
-
bioRxiv - Systems Biology 2021Quote: ... Libraries of extracted RNAs whose A260/A280 >1.8 and RIN >8 were built using the Illumina TruSeqTM RNA sample preparation kit (RS-122-2001, Illumina) and sequenced by an illumina HiSeq 2000 system with paired-end 100-bp reads ...
-
bioRxiv - Cell Biology 2019Quote: ... 100 to 200ng of high-quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Genomics 2021Quote: ... The cell pellets were then resuspended in 20 μl, 10 μl, and 8 μl of transposition mix (25 μl 2×TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Neuroscience 2023Quote: ... 8 µL was amplified and hybridized on the Infinium MehtylationEPIC BeadChip (EPIC array; Illumina, Inc., San Diego, CA, U.S.A.). All samples were randomized in a balanced manner for sex and Braak stage ...
-
bioRxiv - Immunology 2022Quote: ... 5,000-50.000 cells per experiment were centrifuged 5 minutes at 8°C, and resuspended in 25 µl transposase mixture (12.5 µl Tagmentation DNA buffer, 1 µl Tn5 transposase (Illumina), 10.75 µl nuclease-free water ...
-
bioRxiv - Genomics 2023Quote: ... 8 μl of modified DNA was subjected to methylation analysis on the Illumina Infinium MethylationEPIC BeadChip (Illumina, CA, USA) at UCL Genomics according to the manufacturer’s standard protocol.
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Genomics 2020Quote: ... Other libraries were sequenced on NextSeq 500 (1x 28 / 1×91 cycles plus 8 base index cycle) using the v2 150 cycle High Output kit (Illumina) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 150 µl from the 14 pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genetics 2020Quote: ... Libraries that passed quality checks were then subjected to deep sequencing (8-47 × genome coverage; 19 × mean coverage, 11 × median coverage) by HiSeq 2500 (Illumina) or NovaSeq 6000 platforms (Illumina).
-
bioRxiv - Genomics 2019Quote: ... Libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (6 libraries per lane) or HiSeq 4000 (8 libraries per lane)(Illumina).
-
bioRxiv - Genetics 2019Quote: ... A subgroup of subjects comprising 48 SA and 48 non-SA were chosen for the pilot genome-wide genotyping assay in Illumina iScan system using the HumanOmni ZhongHua-8 v1.3 DNA Analysis BeadChip Kit (Illumina, Inc.) at the Li Ka Shing Institute of Health Sciences of the Chinese University of Hong Kong ...
-
bioRxiv - Cell Biology 2019Quote: ... RNA samples with a RNA Integrity Number > 8 were used for library preparation using the protocol for the TruSeq Stranded mRNA library kit (Illumina) on the Illumina Neoprep automated microfluidic library prep instrument ...
-
bioRxiv - Cell Biology 2021Quote: ... 8 bases for index 1 and 8 bases for index 2) using the NextSeq 500 High Output Kit 75-cycles (#FC-404-1005, Illumina) loaded at 1.8pM and including 1 % PhiX ...
-
bioRxiv - Molecular Biology 2020Quote: One μg of total RNA of high quality (RIN>8) was used for sequencing with a TruSeq RNA sample preparation kit (Illumina). We here included 99 islet samples in addition to the 89 islet samples and processed them uniformly following the same protocol as described previously (8) ...
-
bioRxiv - Genomics 2021Quote: ... for 4000 cells was performed according to manufacturer’s instructions and the libraries were paired-end sequenced (R1:27, i7-index:8, R2:98) on HiSeq 4000 (Illumina). Preprocessing of scRNA-seq data ...
-
bioRxiv - Neuroscience 2020Quote: ... we used one batch of 20 ng of total photoreceptor (n = 8) RNA and 30 ng for the other three batches (n = 24) according to the manufacturer’s protocol (Illumina Platforms). For generating libraries from RPE samples we used 20 ng of RNA ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 100 μl from the 16 pM pool were loaded into each well of an 8-well strip tube and placed onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genomics 2019Quote: ... The Agilent 2100 Bioanalyzer was used to assess RNA quality and only high quality RNA (RIN > 8) was further processed for removal of ribosomal RNA with the Ribo-Zero Magnetic Gold Kit (Human/Mouse/Rat; Illumina). Ribosomal-depleted RNA was used as input for library preparation with Illumina TruSeq V2 RNA prep kit and processed according to the manufacturer’s instruction ...
-
bioRxiv - Genomics 2020Quote: Peripheral blood DNA genotypes were obtained for 238 subjects using Infinium Multi-Ethnic Global-8 Kit (Illumina, San Diego, CA) and processed with GenomeStudio software ...
-
bioRxiv - Genetics 2020Quote: Nextera barcode adapters were added to can1 amplicons and were then minimally PCR amplified (8 cycles) for attachment of Illumina Nextera XT index primers set A (Illumina). After PCR ...
-
bioRxiv - Immunology 2020Quote: ... High-quality RNA (approximately 500 ng; RIN 8) was used for nondirectional paired-end mRNA library preparation (TruSeq Sample Preparation Kit; Illumina).
-
Glycogen Synthase Kinase 3 regulates the genesis of the rare displaced ganglion cell retinal subtypebioRxiv - Neuroscience 2021Quote: ... Stranded RNA-Seq libraries were constructed from 100 ng high-quality total RNA (RIN > 8) using the TruSeq Stranded mRNA Library Preparation Kit (Illumina). Paired-end sequencing of 40 bases length was performed on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Developmental Biology 2022Quote: ... 3’RNA libraries were prepared by GenoBiRD core facility according to their published method (47) and sequenced on 8 individual runs on a NovaSeq 6000 or HiSeq 2500 Sequencing System (Illumina).