Labshake search
Citations for Illumina :
51 - 100 of 900 citations for 3 Phenoxybenzoic Acid Phenoxy 13C6 99% 100 Ug Ml In Acetonitrile since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina, Illumina, San Diego, CA, USA). Transcriptome sequencing was performed using the Illumina Hi-Seq 2000 platform ...
-
bioRxiv - Genetics 2023Quote: ... and iSeq 100 (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... Approximately 5 ug of total RNAs were used to construct cDNA libraries (NEBNext Ultra Directional RNA Library Prep Kit for Illumina, Illumina, San Diego, CA, USA). Transcriptome sequencing was performed using the Illumina Hi-Seq 2000 platform ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA quality was determined and 1 ug RNA was used in library preparation using TruSeq RNA library preparation kit (Illumina, cat no RS-122-2001). Library preparation was performed according manufacturers protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2023Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Molecular Biology 2021Quote: ... Samples were sequenced with NovaSeq 6000 S1 PE 100 or SP SE 100 (Illumina).
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2019Quote: ... the 16S rRNA sequences covering the V6-V7-V8 variable regions (5’ ACACTGACGACATGGTTCTACA 3’ and 5’ TACGGTAGCAGAGACTTGGTCT 3’) were PCR amplified and sequenced by Illumina MiSeq PE250 (paired-end) ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cycle strategy (Illumina Inc.). The raw data were analyzed by Next Generation Diagnostics srl proprietary 3’DGE mRNA-seq pipeline (v1.0 ...
-
Multiomic Approach Characterises the Neuroprotective Role of Retromer in Regulating Lysosomal HealthbioRxiv - Neuroscience 2022Quote: ... 100 cycle strategy (Illumina Inc.).
-
bioRxiv - Cell Biology 2023Quote: ... 100 cycle strategy (Illumina Inc.).
-
bioRxiv - Developmental Biology 2023Quote: ... 100 cycles kit (Illumina, USA). The output was ∼ 25 million single end- 120 bp reads per sample.
-
bioRxiv - Cancer Biology 2024Quote: ... 100 cycle strategy (Illumina Inc.). The raw data were analysed as follow ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
bioRxiv - Genomics 2019Quote: ... to generate ~3 GB data (Illumina, Inc, USA). The total yield of the Number of Paired end was 26,263,128 with the maximum data of 3.78 GB ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2023Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2019Quote: 16S amplicon sequencing targeting the V3 and V4 variable regions of the 16S rRNA (341F: 5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 805R: 5’- GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATC C-3’) was performed on the Illumina MiSeq platform (Illumina, California, USA) according to manufacturer’s guidelines and generated paired-end reads of 300bp in each direction ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... 2 μl of the v1.5 sRNA 3’ adapter (Illumina) was mixed with the 14 μl eluate of the previous step in a 200 μl nuclease-free ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Neuroscience 2022Quote: ... 100 cycles (Illumina; paired-end sequencing).
-
bioRxiv - Genetics 2020Quote: ... 100 cycles flow cell (Illumina Inc.). Amplified fragmented cDNA of 300 bp in size were sequenced in single-end mode with a read length of 100 bp ...
-
bioRxiv - Microbiology 2022Quote: ... with the iSeq 100 system (Illumina) and an output of 2 x 150 bp paired-end reads.
-
bioRxiv - Genomics 2021Quote: ... 100 nM Nextera Tn5 Transposase (Illumina), 33 μl PBS ...
-
bioRxiv - Genetics 2020Quote: ... sequencing (Illumina 100 bp paired-end), trimming and demultiplexing was performed by BGI (Hong Kong ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...
-
bioRxiv - Microbiology 2019Quote: ... and the primers V3F - 5’-CCTACGGGNGGCWGCAG-3’ and V4R – 5’-GACTACHVGGGTATCTAATCC-3’ [28] with the addition of the appropriate Illumina Nextera XT overhang adapter sequences (Illumina, San Diego, CA, USA). Following purification using a magnetic bead capture kit (Ampure ...
-
bioRxiv - Cancer Biology 2022Quote: ... was used with 100 ng input RNA and 2x 100 bp were sequenced on a HiSeq 4000 (Illumina) or a NovaSeq 6000 system (Illumina).
-
bioRxiv - Molecular Biology 2019Quote: ... and 3’ end adenylation per the TruSeq protocol (Illumina, Inc.), libraries were constructed using an Apollo 324 automated library system ...
-
bioRxiv - Molecular Biology 2019Quote: ... v1.5 small RNA 3’ adaptor kit (Illumina FC-102-1009) or by using TruSeq directional small RNA kit (Illumina RS-200-0012) ...
-
bioRxiv - Genomics 2019Quote: ... the sequence 3’ of the indices were bound by Illumina’s Sequencing Primers ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... 2.5 µL transposase (100 nM final; Illumina), 16.5 µL PBS ...
-
bioRxiv - Plant Biology 2021Quote: ... with 100 bp single-end reads (Illumina). All sequencing was conducted at the Roy J Carver Biotechnology Center at the University of Illinois.
-
bioRxiv - Microbiology 2021Quote: ... The tar get band (Illumina: ~100 bp) was excised from 8% (wt/vol ...
-
bioRxiv - Genomics 2022Quote: ... 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...