Labshake search
Citations for Illumina :
51 - 100 of 818 citations for 3 Bromo 4 8 dichloro 5 methoxyquinoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... Paired-end 100-cycle sequencing (Run configuration: 101-8-8-101) was carried out on a NovaSeq 6000 (Illumina) to a depth of at least 30,000 reads per nucleus in the St ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1.5 μl of PCR 1 were used as template for PCR 2 (14 cycles) and used forward primers 5’-AATGATACGGCGACCACCGAGATCTACAC-NNNNNNNN-ACACTCTTTCCCTACACGAC-3’ (compatible to Illumina i5) and reverse primers 5’-CAAGCAGAAGACGGCATACGAGAT-NNNNNNNN-GTGACTGGAGTTCAGACGTG-3’ (compatible to Illumina i7) ...
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Microbiology 2021Quote: ... The purified PCR products were then processed and sequenced using the NextSeq 75 – High Output (82 cycles in read 1, 8 cycles in index 1, and 8 cycles in index 2 SE reads) (Illumina). The sequencing data was analyzed using the Model-Based Analysis of Genome-wide CRISPR/Cas9 Knockout (MAGeCK ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Paired-End 51 bases (in addition: 8 bases for index 1 and 8 bases for index 2) setup using the NovaSeq 6000 instrument (Illumina). SP Flow-Cell was loaded at a final concentration in Flow-Lane loaded of 400pM and including 1% PhiX ...
-
bioRxiv - Neuroscience 2024Quote: ... Libraries were sequenced Single-reads 76 bases (in addition: 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 (Illumina) using the NextSeq 500 High Output Kit 75-cycles (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... The 3’ preadenylated linker (NEBNext 3’SR adaptor for Illumina; /5rApp/AGA TCG GAA GAG CAC ACG TCT /3AmMO/ ...
-
bioRxiv - Cell Biology 2024Quote: ... 3’ poly(A) tail and the 3’ adapter from Illumina were trimmed with the TrimGalore 0.06.10 tool (Babraham Bioinformatics ...
-
bioRxiv - Molecular Biology 2024Quote: ... purified and ligated to 3′ and 5′ RNA adapters derived from TruSeq Small RNA Library Preparation Kit (Illumina, San Diego, CA, USA). Small RNA libraries were created using TruSeq Small RNA Library Preparation Kit (Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... 3’-adapter (Illumina) ligation was performed ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter ...
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
bioRxiv - Neuroscience 2021Quote: ... a forward primer 5′-CTT TCC CTA CAC GAC GCT CTT CCG ATC TAC GGR AGG CAG CAG-3 (28-nt Illumina adapter (in bold) followed the 14 nt broad range bacterial primer 343F ...
-
bioRxiv - Cell Biology 2020Quote: ... DNA fragments were end-paired and phosphorylated at the 5’ end and successively adenylated at the 3’ end (following Illumina paired-end protocols), and the libraries ligated to the precapture adaptor were amplified and indexed via PCR ...
-
bioRxiv - Genomics 2020Quote: ... Genotyping was performed using Infinium Omni2.5-8 arrays (Illumina) at the UCSD Institute for Genomic Medicine ...
-
bioRxiv - Genomics 2020Quote: ... Genotyping was performed using Infinium Omni2.5-8 arrays (Illumina) at the UCSD Institute for Genomic Medicine ...
-
bioRxiv - Developmental Biology 2024Quote: ... Pooled libraries with unique 5′ and 3′ index adapter pairs were sequenced on an NextSeq 2000 P3 flow cell (Illumina®: San Diego, CA) to generate 66M (±12M ...
-
bioRxiv - Genomics 2022Quote: ... and DRB3, 4, 5 (exon 2) genes with Fluidigm Access Array (Fluidigm, Singapore) and sequenced on an Illumina MiSeq sequencer (Illumina, San Diego, USA). HLA alleles and genotypes are called using the Omixon HLA Explore (version 2.0.0 ...
-
bioRxiv - Microbiology 2020Quote: ... then further diluted to 8 pM in HT1 buffer (Illumina) and were sequenced using an Illumina MiSeq V2 500 cycle kit cassette with 16S rRNA library sequencing primers set for 250 base pair ...
-
bioRxiv - Immunology 2023Quote: ... 8 bp Index 1 on a NextSeq 550 sequencer (Illumina). Primers used for sample indexing PCR are listed in Extended Data Table 5.
-
bioRxiv - Neuroscience 2024Quote: ... Unique dual 8 bp adapters (1.5 μM) (IDT for Illumina) were used for indexing ...
-
bioRxiv - Microbiology 2021Quote: ... 3) DC3000 + A (Illumina only), 4 ...
-
bioRxiv - Immunology 2021Quote: ... Group 3 (North America, Illumina), Group 4 (French European ...
-
bioRxiv - Systems Biology 2024Quote: ... 5’ amine-modified DNA oligonucleotides (5’-[AmC6]dUdUdUdUd-[Illumina_adaptor]-[spatial barcode]-[UMI]-[20T]-VN ...
-
bioRxiv - Immunology 2022Quote: ... Index read 1:8 cycles or on a HiSeq X (Illumina), using a 150 cycle flowcell with the read configuration ...
-
bioRxiv - Molecular Biology 2024Quote: ... Sequencing (2×50+8) was performed using NovaSeq 6000 machine (Illumina) by Fasteris S ...
-
bioRxiv - Cell Biology 2024Quote: ... containing 8 µL of Tn5 Transposes (Illumina Cat #FC-121-1030) and 17 µL of nuclease-free water ...
-
bioRxiv - Genomics 2020Quote: ... 64 RNA-Seq libraries (4 time points x 4 tissues x 4 biological replicates) were prepared using the TruSeq RNA Sample Preparation Kit (Illumina). Libraries were sequenced on Illumina Nova-Seq 6000 sequencing platform at the Australian Genome Research Facility (AGRF ...
-
bioRxiv - Developmental Biology 2024Quote: ... we prepared n=40 sequencing libraries from 1µg total RNA per sample using Illumina® Stranded mRNA Prep kits with unique 5′ and 3′ index adapter pairs (IDT for Illumina® RNA UD Indexes, Set A). Libraries were PCR amplified for 10 cycles ...
-
bioRxiv - Microbiology 2021Quote: ... The 8 pM library containing 15% PhiX control v3 (Illumina Canada, Canada) was sequenced on a MiSeq instrument (Illumina Inc ...
-
bioRxiv - Immunology 2020Quote: ... cell nuclei were isolated and transposed with 8 μL Tn5 (Illumina Nextera) at 37°C for 60 minutes ...
-
bioRxiv - Bioengineering 2023Quote: Total RNA samples (RIN > 8) were sequenced on HiSeq 1500 (Illumina Inc.) using HiSeqV2 Rapid chemistry according manufacturer’s instructions in Monash Health Translation Precinct RNA-Seq facility ...
-
bioRxiv - Microbiology 2023Quote: ... Small RNA Seq 3’ adapters (Illumina) were ligated using T4 RNA ligase (NEB ...
-
bioRxiv - Immunology 2023Quote: ... 3’ adapters (Illumina Universal Adapter, Illumina Multiplexing Adapter ...
-
bioRxiv - Microbiology 2021Quote: ... 4) DC3000 + B (Illumina only), 5 ...
-
bioRxiv - Immunology 2021Quote: ... Group 4 (French European, Illumina), Group 5 (North American ...
-
bioRxiv - Bioengineering 2024Quote: ... and 4 µL Nextera (Illumina). The reaction was stopped with 1% SDS and incubated at 72C for 10 minutes ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Systems Biology 2023Quote: ... and biotinylated as described 8 using HumanHT-12 v4 Expression BeadChips (Illumina, Inc.). Gene expression data were extracted and log2-transformed using GenomeStudio software (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... 8 µL of i7 primer (NEBNext Multiplex Oligos for Illumina (Dual Index primers); NEB #E7600S ...
-
bioRxiv - Microbiology 2024Quote: ... diluted to 8 pM in Illumina’s HT1 buffer (Illumina: San Diego, CA, USA), spiked with 15% PhiX ...
-
bioRxiv - Cancer Biology 2024Quote: ... with 8 cycles and using Nextera XT indexes (Illumina, Cat: # FC-131-1001) according to the 16S Metagenomic Sequencing Library Preparation Protocol from Illumina ...
-
bioRxiv - Microbiology 2020Quote: ... A 5’-adapter (Illumina) was ligated to the RNA fragments with T4 RNA ligase (Promega) ...
-
bioRxiv - Genomics 2023Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Genomics 2024Quote: ... 5 uL H2O) (Illumina Tagment DNA Enzyme and Buffer Small Kit ...
-
bioRxiv - Neuroscience 2021Quote: ... and TruSeq SBS Kit 3-HS (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.