Labshake search
Citations for Illumina :
51 - 100 of 1530 citations for 3 2 Methylphenoxy methyl piperidine hydrochloride since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2024Quote: ... and an independent validation set (3 Illumina HumanMethylation450K array studies ...
-
bioRxiv - Genomics 2024Quote: ... and reverse oligos (3’ P7 Illumina adapter). The GRB2-SH3 bPCA library was single-indexed using a constant forward oligo (3’ P7 Illumina adapter ...
-
bioRxiv - Microbiology 2021Quote: ... version 2 (Illumina). Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH ...
-
bioRxiv - Cell Biology 2022Quote: ... version 2 (Illumina) using 10 PCR cycles ...
-
Microplastic consumption induces inflammatory signatures in the colon and prolongs a viral arthritisbioRxiv - Immunology 2021Quote: ... for RNA extraction and 16S sequencing using V3-V4 region primers (Forward 5’- CCTAYGGGRBGCASCAG -3’ and Reverse 5’- GGACTACNNGGGTATCTAAT -3’. Sequencing was performed on an Illumina MiSeq platform.
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2022Quote: ... Extracted DNA was PCR-amplified (F 5’ – GTGCCTTCTCCGTCAGTCTC – 3’, R 5’ – GCAGGCACAAATCCAAGTTT – 3’, and subsequently subjected to next-generation sequencing in an Illumina MiSeq platform 116 ...
-
bioRxiv - Microbiology 2020Quote: ... Microbiome communities in ligatures were characterized by sequencing of the 16S rRNA V1-V2 region using primers 8F 5’- AGAGTTTGATCMTGGCTCAG-3’ and 361R 5’- CYIACTGCTGCCTCCCGTAG-3’ which included the adapter for MiSeq sequencing (Illumina) and single end barcodes (4) ...
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Neuroscience 2022Quote: ... The Genomics Facility at the Cornell Institute of Biotechnology used 500ng of RNA/sample for 3’RNA library preparation with the Lexogen QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina), sequenced libraries on an Illumina NextSeq500 sequencer (single end 1×86bp) ...
-
bioRxiv - Microbiology 2023Quote: The V3/V4 variable region of the 16S rRNA gene was amplified using primers 341F 5’CCTACGGGNGGCWGCAG′3 and 785R 5′GACTACHVGGGTATCTAATCC′3 (Klindworth et al., 2013 with Illumina Nextera XT overhang adapters for a dual-barcoding PCR library preparation approach ...
-
bioRxiv - Microbiology 2024Quote: ... 16S rRNA PCR amplification and next-generation sequencing were performed at MR DNA (www.mrdnalab.com) using primers 515F-Y (5’-GTGCCAGCMGCCGCGGTAA-3’)73 and 806R (5’-GGACTACHVGGTWTCTAAT-3’)74 using Illumina MiSeq (Illumina Corp) 2x300 paired- end reads ...
-
bioRxiv - Cancer Biology 2024Quote: ... followed by PCR amplification of the gRNAs using forward (5’-CGATACAAGGCTGTTAGAGAGATA-3’) and reverse (5’-GTTGCTATTATGTCTACTATTCTTTCCC-3’) primers and NEBNext HighFidelity 2X PCR Master Mix (Illumina). Library preparation was performed with the Nextera DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Biophysics 2021Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Table S1) ...
-
A tale of two transcriptomic responses in agricultural pests via host defenses and viral replicationbioRxiv - Genomics 2020Quote: ... A TruSeq SBS sequencing kit version 3 (Illumina) was used following the manufacturer’s instructions to generate the sequencing libraries ...
-
bioRxiv - Biophysics 2023Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (Supplementary Table 3 ...
-
bioRxiv - Biophysics 2022Quote: ... while the reverse primer (3’ P7 Illumina adapter) differed by the barcode index (oligo sequences in Supplementary Table 1) ...
-
bioRxiv - Genomics 2024Quote: ... and alternating reverse oligos (3’ P7 Illumina adapter). The demulitplexing primers used for PCR2 are listed in Extended Data Table 4 ...
-
bioRxiv - Immunology 2024Quote: ... using the TruSeq SBS Kit v.3 (Illumina). An average of 75 million paired reads was generated per sample.
-
bioRxiv - Molecular Biology 2023Quote: ... and each sample was sequenced in 3 different lanes (3 technical replicates per sample) on an Illumina HiSeq platform (Illumina, USA).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Neuroscience 2024Quote: Biomarker Core Facility at King’s College London for library preparation (single cell 3’ version 3 on a Chromium 10X instrument) and sequencing (Illumina NextSeq system).
-
bioRxiv - Genomics 2020Quote: ... 300×2 bp or 150×2 bp (Illumina, Inc., San Diego, CA).
-
bioRxiv - Plant Biology 2022Quote: ... 2 (Illumina, CA, USA). The two types of libraries ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 μl transposase (Illumina), 10.5 μl nuclease-free water and 0.01% NP-40 ...
-
bioRxiv - Immunology 2021Quote: ... Group 2 (France, Illumina), Group 3 (North America ...
-
bioRxiv - Microbiology 2023Quote: ... and 2 from Illumina libraries.
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, CA, USA). ASVs were inferred using DADA2 v ...
-
bioRxiv - Neuroscience 2021Quote: ... using TruSeq SR Cluster Kit 3-cBot-HS (Illumina) and TruSeq SBS Kit 3-HS (Illumina ...
-
bioRxiv - Immunology 2024Quote: ... 3 biological replicates were sequenced with NextsSeq 550 (Illumina). For data analysis ...
-
bioRxiv - Microbiology 2023Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR with universal bacterial primer sets (5’-TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAATCC-3’) and was sequenced using MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were analyzed using QIIME2 (https://qiime2.org/ ...
-
bioRxiv - Developmental Biology 2024Quote: ... library construction was immediately carried out using a Chromium Single Cell 3’ Reagent Kit (Version 3) and sequenced on an Illumina HiSeq 4000 or an Illumina NextSeq2000 (Illumina, cat no. 20040559) by the Technion Medicine Faculty Azrieli-Technion Genomics Center ...
-
bioRxiv - Microbiology 2024Quote: ... The V3-V4 region of the 16S ribosomal RNA gene was amplified by PCR using universal bacterial primer sets (5’-TCGTCGG-CAGCGTCAGATGTGTATAAGAGACAGCCTACGGGNGGCWGCAG-3’ and 5’-GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGG-TATCTAATCC-3’) and sequenced using the MiSeq Reagent kit v3 (600 cycle) (Illumina Inc., California, US). The sequence data were processed using QIIME2 (version 2020.2 ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... High-throughput genome sequencing was performed either on Hiseq 2000 (2 × 100 or 2 × 150 paired-end reads) or Miseq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA) following the manufacturer ‘s instruction.
-
bioRxiv - Physiology 2021Quote: ... High-throughput genome sequencing was performed on a HiSeq 2500 (2 × 100 or 2 × 150 paired-end reads) or MiSeq (2 × 300 paired-end reads) sequencer (Illumina, San Diego, CA), following the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... The 33 samples were combined into 2 pools and sequenced using 2 NovaSeq (Illumina) S4 200 cycle flow cells.
-
bioRxiv - Cell Biology 2020Quote: ... and D (v.2, Illumina) and sequenced on HiSeq4000 and NovaSeq6000 (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... 2 μl Tn5 enzyme (Illumina), 0.25 μl 1 % digitonin ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 22M reads at Novogene (Beijing ...
-
bioRxiv - Genetics 2023Quote: 2×150bp reads from Illumina NovaSeq were obtained for all samples with a minimum depth of 17 M reads at Novogene (Beijing ...
-
bioRxiv - Molecular Biology 2023Quote: ... and 2) Detection from Illumina RNA-seq data through SL leader sequence trimming(43) ...
-
bioRxiv - Plant Biology 2023Quote: ... with the MiSeq reagent kit version 3 (600 cycles; Illumina). The reads were cleaned up using the cutadapt ver ...
-
bioRxiv - Cancer Biology 2021Quote: ... 2 × 150 bp flow cells (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing (Illumina HiSeq 2 × 150bp) were all performed at GeneWiz ...
-
bioRxiv - Synthetic Biology 2023Quote: ... 2% PhiX (PhiX Control v3, Illumina) was spiked into the sample and 20 µL were added to an Illumina iSeq 100 i1 Reagent v2 cartridge ...
-
bioRxiv - Biochemistry 2024Quote: ... Round 2 primers (Illumina TruSeq Adapters) were added to each reaction to 400 nM ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2×150 cycle strategy (Illumina Inc.). Paired-end reads were produced with a 100x coverage ...
-
bioRxiv - Immunology 2023Quote: ... Sequencing was performed in 3 sequencing unit of NovaSeq 6000 (Illumina) (100-nt-length reads ...
-
bioRxiv - Immunology 2023Quote: ... dual-indexed 3’ DGE libraries were prepared using Nextera XT (Illumina) and sequenced to depth on the NovaseqS4 platform with a paired-end read structure (R1 ...
-
bioRxiv - Immunology 2023Quote: The 3’ adapters were ligated according to the TruSeq kit (Illumina) manufacturer’s instructions ...