Labshake search
Citations for Illumina :
51 - 100 of 2301 citations for 2 Chloro 1 1 trifluoromethyl 1 3 4 9 tetrahydro 2H beta carbolin 2 yl ethan 1 one since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... whose lengths were about 600 base pairs were sequenced using an Illumina Novaseq 6000 S4 flowcell (67 bp read 1 and 140 bp read 2) (Illumina, USA). Only read2 contained the sequence regarding the definition of T cell clones.
-
bioRxiv - Genomics 2024Quote: Both read 1 and read 2 files from each spatial region were mapped to the mm10 reference genome (source: Illumina igenomes) using the bowtie2 package (v2.5.1 ...
-
bioRxiv - Molecular Biology 2024Quote: ... the pool of plasmids for each library (inputs) was amplified using primers bearing sequences from Illumina (Read 1 and Read 2) and complementary to PT1 and down to Moe (Figure 1C) ...
-
bioRxiv - Genomics 2024Quote: We then pooled the original and targeted libraries at a 2:1 molar concentration and sequenced them together on a NovaSeq 6000 (Illumina, 20012850) with a S1 Reagent Kit v1.5 (200 cycles ...
-
bioRxiv - Genetics 2024Quote: ... 1 µg of total RNA was used with the TruSeq RNA Sample Prep Kit v.2 (Illumina, San Diego, CA, USA). The cDNA libraries were quantified by quantitative Real-Time PCR (qPCR) ...
-
bioRxiv - Molecular Biology 2021Quote: ... libraries from amplicons 1–4 were mixed with 5% PhiX DNA control library (Illumina) and sequenced ...
-
bioRxiv - Genomics 2021Quote: ... We used one of the cohorts for our main analyses (AEMS450K1, Athero-Express Methylation Study Illumina 450K 1) and the other smaller cohort for replicating the effect size of methylation sex differences (AEMS450K2 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1% of PhiX (Illumina) was used as run control ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Bioengineering 2023Quote: ... 10x libraries were pooled and charged with 1% PhiX on one SP lane of the NovaSeq 6000 instrument (Illumina) using the NovaSeq 6000 SP Reagent Kit v1.5 Raw sequencing data of the modules viability study were processed with Cellranger80 ...
-
bioRxiv - Physiology 2024Quote: ... 10x libraries were pooled and charged with 1% PhiX on one S1 lane of the NovaSeq 6000 instrument (Illumina) using the NovaSeq 6000 S1 Reagent Kit v1.5 (100 cycles) ...
-
bioRxiv - Genomics 2023Quote: ... coverage and eight additional female genomes (4 Asian and 4 African) at ~30× (1 lane of Illumina Hiseq X Ten) coverage using 10x Linked-Reads at HudsonAlpha Institute of Biotechnology ...
-
bioRxiv - Microbiology 2023Quote: ... 1 μl of forward and 1 μl of reverse 25 μM PCR primers (Illumina), and 0.5 μl of Phusion high-fidelity DNA polymerase (New England Biolabs) ...
-
bioRxiv - Neuroscience 2023Quote: ... collected with the magnet and resuspended in 24ul of Tagmentation Mix (1:1 Illumina 2× Tagmentation buffer ...
-
bioRxiv - Immunology 2021Quote: ... Group 1 (The Netherlands, Illumina), Group 2 (France ...
-
bioRxiv - Microbiology 2021Quote: ... 1×75 cycles (Illumina, USA). Image analysis was performed in real time by the NextSeq Control Software and Real Time Analysis running on the instrument computer ...
-
bioRxiv - Systems Biology 2022Quote: ... 1% PhyX spike-in (Illumina) was added then pooled ...
-
bioRxiv - Immunology 2024Quote: ... 1 µL of TDE1 (Illumina), 0.25 µL of 5% digitonin (Promega) ...
-
bioRxiv - Plant Biology 2021Quote: ... 10 ng of template DNA and index primer 1 (N7xx) and index primer 2 (N5xx) of Nextera XT Index Kit v2 Set A (Illumina, San Diego, CA, USA) according to the manufacturer’s instruction ...
-
bioRxiv - Physiology 2020Quote: ... RNA-seq libraries were sequenced using paired-end reads (50-nt read 1 and 25-nt read 2) on a NextSeq 500 instrument (Illumina, San Diego, CA, USA). Obtained reads were mapped to the mouse GRCm38.p6 genome using STAR (version 2.7.3a) ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...
-
bioRxiv - Cell Biology 2024Quote: ... 8 bases for index 1 and 8 bases for index 2) on NextSeq 500 using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005). Flow lanes were loaded at 1.8pM ...
-
bioRxiv - Bioengineering 2023Quote: ... Sequencing was performed in paired-end mode with HighOutput flow cell (read 1: 28 cycles and read 2: 90 cycles) and a NextSeq 550 sequencer (Illumina, San Diego, CA, USA) at the Transcriptome Core Facility of the Institute in Regenerative Medicine and Biotherapy ...
-
bioRxiv - Genomics 2022Quote: ... 2 μg of Rohu-1 genomic DNA was used with an Illumina TruSeq DNA PCR-free Library Prep Kit (Illumina, San Diego, CA, USA) to create an Illumina sequencing library ...
-
bioRxiv - Genetics 2024Quote: ... which uses proximity extension assay technology coupled to a readout methodology based on next generation sequencing (Illumina NovaSeq 6000, NextSeq 550, and NextSeq 2000; all manufactured by Illumina; appendix 1 p 2), to quantify protein targets ...
-
bioRxiv - Genomics 2022Quote: ... then single-end sequenced (1 x 100 bp) on one lane using TrueSeq PE150 kit (Illumina, Inc., San Diego, CA) on an Illumina HiSeq 2000 instrument ...
-
bioRxiv - Microbiology 2020Quote: ... NGS sequencing was accomplished using MiSeq v.3 2×75 chemistry (Illumina). Raw sequencing files were demultiplexed using IlluminaBasecallsToFasq procedure from PICARD package and mapped to NC_055512.2 SARS-CoV-2 reference sequence with BwaAndMarkDuplicatesPipelineSpark procedure from GATK v.4.1.5.0 package (Broad Institute ...
-
bioRxiv - Microbiology 2023Quote: ... version 3 (2×300 bp read length; Illumina, San Diego, CA, USA).
-
bioRxiv - Molecular Biology 2024Quote: ... 1 ng of PCR-1 product was used as template with TruSeq indexing primers (Illumina) and 10 cycles of PCR ...
-
bioRxiv - Genetics 2021Quote: ... A second PCR step was run to add the index primers for sequencing (NEBNext Multiplex Oligos for Illumina Dual Index Primers Set 1 and 2). PCR products were purified using SPRIselect beads (Beckman ...
-
bioRxiv - Cancer Biology 2020Quote: ... sequencing was run in the rapid run flow cell and paired-end sequenced (read 1 – 26 bp, read 2 – 100 bp) on a HiSeq 1500 (Illumina, San Diego, CA 92122 USA).
-
bioRxiv - Cancer Biology 2023Quote: ... we dispensed 600 nL of tagmentation reaction mix containing Tagmentation DNA buffer (TD) and Amplicon Tagment Mix (ATM) at 2:1 v/v ratio (Nextera kit, Illumina, cat. no. FC-131-1096) into each well and performed tagmentation at 55° C for 5 min followed by hold at 4° C in a PCR thermocycler ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing was run in the rapid run flow cell and paired-end sequenced (read 1 – 26 bp, read 2 – 100 bp) on a HiSeq 1500 (Illumina, San Diego, CA 92122 USA). To minimize batch effects ...
-
bioRxiv - Genomics 2023Quote: We sequenced one elephant reference genome (Em538) to ~60× (2 lanes of Illumina Hiseq X Ten) coverage and eight additional female genomes (4 Asian and 4 African ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2 or 4 nM concentration and run on NextSeq 550 sequencer (Illumina) with NextSeq 500/550 High Output v2.5 (75 cycles PE ...
-
bioRxiv - Genomics 2024Quote: ... Miniaturization involved testing libraries at 1/6th (IDT mini) or 1/8th (Roche mini, Illumina mini) of reaction volume tailoring input DNA to each kit between 24-45 ng total (Table 2) ...
-
bioRxiv - Neuroscience 2021Quote: ... 1 μtagment DNA enzyme (Nextera, Illumina), l nuclease free water ...
-
bioRxiv - Immunology 2021Quote: ... 1 μl of transposase (Nextera, Illumina) was added and samples were incubated at 37°C for 10 minutes followed by two washes with low-salt buffer ...
-
bioRxiv - Cell Biology 2024Quote: ... A 1% PhiX sequencing control (Illumina) was spiked in ...
-
bioRxiv - Genomics 2020Quote: ... sequencing libraries were prepared from 1 ng gDNA using the Nextera XT Library Preparation Kit v.3 (Illumina) and sequenced on the Illumina NextSeq system (paired end 2 x 150 bp insert size) ...
-
bioRxiv - Molecular Biology 2024Quote: Multiplexed ChIP-seq libraries were prepared using the NEBNext® Ultra™ II DNA Library Preparation kit (E7103S) with 25-50 ng of input or IP DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina [Set 1, E7335] & [Set 2, E7500]). 150-nucelotides (150- nt ...
-
bioRxiv - Immunology 2020Quote: ... cells were lysed in lysis buffer for 1 minute and transposed with Tagment DNA Enzyme 1 (Illumina) for 30 minutes ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were each sequenced on one full 2 × 150 bp PE (paired end) HiSeq 4000 lane (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... one PCR reaction of 12 cycles was performed (using 2 µL of 3C library, 0.2 µM Illumina primers PE1.0 and PE2.0 and 1 unit of Taq Phusion [Finnzymes]) ...
-
bioRxiv - Genomics 2023Quote: ... indexed using IDT for Illumina Nextera UD indexes Sets 1–4 (384 Indexes, Cat no: 20043137, Illumina, USA) and products were amplified ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
bioRxiv - Plant Biology 2022Quote: ... We prepare 12 cDNA libraries (3 individuals □ 2 sampling times (dawn and dusk) □ 2 localities) using the TruSeq RNA-seq library prep kit from Illumina (Illumina, Inc., CA, USA) according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
bioRxiv - Genetics 2020Quote: ... using a bead-to-DNA ratio of 1:1 before high-throughput sequencing on the MiniSeq system (Illumina). Libraries were sequenced 1 × 75bp for a minimum coverage of 2 million read depth ...