Labshake search
Citations for Illumina :
9501 - 9550 of 10000+ citations for Rat Orexin Receptor Type 2 HCRTR2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on an Illumina NextSeq sequencing system using NextSeq 500 Mid- and High-Output 150 cycle kits (75 bp, paired-end; Illumina, San Diego, CA). Quality control was performed on the raw reads using RNA-SeQC (v1.1.7) ...
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 ng of the amplified cDNA was converted into the sequencing library with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024), according to the protocol supplied ...
-
bioRxiv - Cell Biology 2021Quote: ... Sequencing were performed on the Illumina HiSeq 4000 paired end at 2x 100 bp (2x at least 40 million reads) using the TruSeq SBS Kit v4-HS (Illumina, Inc, California, USA).
-
bioRxiv - Microbiology 2021Quote: ... Total RNA was normalized to 100 ng prior to random hexamer priming and libraries generated using the TruSeq Stranded Total RNA - Globin kit (Illumina, San Diego, USA). Libraries were assessed on the Fragment Analyzer using the High Sense Large Fragment kit and quantified using a Qubit 3.0 fluorometer (Life Technologies) ...
-
bioRxiv - Cell Biology 2021Quote: ... Eluted libraries were quantified using a Qubit dsDNA HS Assay Kit and sequenced on a NextSeq 500 or Hi-Seq 4000 (Illumina, San Diego, California). A list of the RNA-Seq samples can be found in Supplementary Table 5.
-
bioRxiv - Cell Biology 2021Quote: ... RNA samples were converted to RNA-seq libraries with the TruSeq Stranded Total RNA Library Preparation Gold kit (Illumina, San Diego, CA, USA). This kit was reported to reliably and reproducibly generate libraries from 1-2 ng input RNA (Schuierer et al. ...
-
bioRxiv - Cell Biology 2021Quote: ... After chemical fragmentation by incubating for 15 min at 94°C the sample was directly subjected to the workflow for strand specific RNA-Seq library preparation (NEBNext® Ultra™ RNA Library Prep Kit for Illumina®). For ligation custom adaptors were used (Adaptor-Oligo 1 ...
-
bioRxiv - Cell Biology 2021Quote: ... The mRNA was subsequently fragmented and used for cDNA synthesis and library preparation using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Paleontology 2022Quote: ... DNA extracted from mammoth and sloth boluses were sequenced on an Illumina MiSeq using the 600-cycle v3 kit (Illumina, MS-102-3003), whereas the elephant and modern and paleontological bison samples were sequenced on an Illumina NextSeq 500 system ...
-
Dynamic chromatin organization and regulatory interactions in human endothelial cell differentiationbioRxiv - Developmental Biology 2022Quote: ... RNA-seq libraries were prepared from total RNA (≥200 nucleotides in length) using the TruSeq Stranded Total RNA Ribo-Zero H/M/R kit (Illumina, RS-122-2201). Libraries were paired-end sequenced on a NextSeq 500 (Illumina ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Cancer Biology 2022Quote: Total RNA libraries (COR-L279) and mRNA libraries (H446 and LX22) were constructed using a TruSeq Stranded Total RNA Kit (Illumina, RS-122-2201) and an mRNA Library Prep kit V2 (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... 0.4 μg total RNA was used for RNA-seq library construction by a TruSeq RNA Library Prep Kit V2 (Illumina, RS-122-2001). Both ChIP-seq and RNA-seq libraries were sequenced at the Bauer Core Facility ...
-
bioRxiv - Neuroscience 2022Quote: ... A sequencing library was produced using 0.75 ng of the amplified cDNA in the Nextera XT Library Preparation Kit (Illumina, cat # FC-131-1024). For astrocyte RNA-seq ...
-
bioRxiv - Developmental Biology 2022Quote: ... 200ng of total RNA was used in the reactions for the Illumina TruSeq stranded RNA-seq library preparation kit (Illumina, RS-122-2101) according to the manufacturer’s instructions with the modification to use Superscript III Reverse Transcriptase enzyme (Invitrogen ...
-
bioRxiv - Microbiology 2022Quote: RNA molecules extracted from input and output preparations were used for library preparation using the TruSeq stranded total RNA library prep kit (Illumina, San Diego, California), according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2022Quote: ... paired-end library was prepared using 100 ng of DNA with the Nextera DNA sample preparation kit as per the manufacturer’s instructions (Illumina, Inc., San Diego, USA). This was followed by sequencing on Illumina NextSeq 500 and HiSeq X 10 platforms with a paired-end run of 2×150 bp ...
-
bioRxiv - Molecular Biology 2022Quote: ... and approximately 150 ng of RNA was subjected to rRNA depletion using the Ribo-Zero Gold rRNA Removal Kit (Yeast) (Illumina MRZY1324, now discontinued). Libraries were prepared using the TruSeq Stranded Total RNA kit (Illumina ...
-
bioRxiv - Developmental Biology 2022Quote: ... The barcoded libraries were then pooled at equimolar ratios and sequenced on a NextSeq500/550 instrument (Illumina, 150 cycles High Output kit v2.0) to generate 150-bp single-end reads ...
-
bioRxiv - Developmental Biology 2020Quote: ... 1ug of total RNA was then used to generate sequencing libraries using the TruSeq RNA Sample prep kit v2 (Illumina RS-122-2001), as per recommended instructions ...
-
bioRxiv - Microbiology 2021Quote: ... Next the amplicons were checked for their size and purity on a 1.5 % agarose gel and if suitable subjected to the index PCR using the Nextera XT Index Kit v2 Set C/D (Illumina, FC-131-2003). After index PCR the samples were cleaned again with AmPure XP Beads (Beckman Coulter Life Science Cat ...
-
bioRxiv - Microbiology 2020Quote: ... The genome was sequenced with Illumina technology using a GAIIx sequencing platform on paired-end libraries prepared with the Nextera XT DNA Kit (Illumina, San Diego, CA). A total of 84 contigs (0.5 to 330 kb ...
-
bioRxiv - Plant Biology 2021Quote: RNA-seq libraries were constructed by the POPS platform (IPS2) using the TruSeq no stranded mRNA library prep kit (Illumina®, California, U.S.A.) according to the supplier’s instructions ...
-
bioRxiv - Neuroscience 2021Quote: Library preparation and sequencing of the samples were conducted at the Mayo Clinic Genome Analysis Core using TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA). The library was sequenced on Illumina HiSeq2000 instruments ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 pg of cDNA from each sample was used as input for library preparation with the Nextera XT DNA Library Prep Kit (Illumina FC-131-1096). Fragmentation and adaptors insertion were performed by tagmentation ...
-
bioRxiv - Genomics 2021Quote: ... Genomic DNA libraries for short- and long-read sequencing were generated with the TruSeq DNA PCR-Free Kit (Illumina, San Diego, CA, USA) and the SMRTbell Express Template Prep Kit 2.0 (PacBio ...
-
bioRxiv - Immunology 2020Quote: ... 500 ng of total RNA underwent polyA selection and TruSeq library preparation according to instructions provided by Illumina (TruSeq Stranded mRNA LT Kit), with 8 cycles of PCR ...
-
bioRxiv - Microbiology 2020Quote: ... Individual libraries were constructed from some of the strain DNA preparations described above using an Illumina Nextera XT DNA sample preparation kits with appropriate indices tags according to the manufacturer’s instructions (Illumina Inc., San Diego, CA). The libraries were pooled together and run on an Illumina MiSeq DNA sequencer (Illumina Inc. ...
-
bioRxiv - Microbiology 2021Quote: The cDNA synthesis and library construction were done using a TruSeq Stranded mRNA LT Sample Prep Kit (Illumina Inc., San Diego, CA, USA) following the manufacturer’s protocol ...
-
bioRxiv - Genomics 2020Quote: Messenger RNA capture based libraries were prepared starting from 8.5 µL DNase treated and spike-in supplemented RNA eluate using the TruSeq RNA Exome Library Prep Kit (Illumina, San Diego, CA, USA). Each sample underwent individual enrichment according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... is a 30-gene NGS test for somatic mutations in myeloid neoplasms using the Truseq Amplicon Cancer Panel kit (Illumina, San Diego, CA). It contains amplicons for hot-spot locations of the following genes ...
-
bioRxiv - Cancer Biology 2020Quote: ... Libraries were pooled and single end-sequenced (1×75) on the Illumina NextSeq 500 using the High output V2 kit (Illumina, San Diego, CA). Quality control was performed using Fastqc (v0.11.5 ...
-
bioRxiv - Neuroscience 2020Quote: ... Library preparation for RNA-Seq was performed using the TruSeq™ RNA Sample Prep Kit v2 (Illumina, Cat. N°RS-122-2002, U.S.A.) starting from 50 ng of total RNA ...
-
bioRxiv - Developmental Biology 2021Quote: ... libraries were prepared using the Quant-seq 3’ mRNA Library Prep Kit FWD (Lexogen, Greenland, NH) and single-end 75bp reads were sequenced on the NextSeq 500 (Illumina, San Diego, CA). Genes queried for hiPSC identity were listed on the TaqMan hPSC Scorecard Assay (Thermo Fisher Scientific ...
-
bioRxiv - Neuroscience 2020Quote: ... Next generation sequencing and bioinformatics analysis was performed by the National Genomics Infrastructure (NGI) at the Science for Life Laboratory on the HiSeq 2500 System using the HiSeq Rapid SBS Kit v2 (Illumina, San Diego, CA) generating >13.5 M reads/sample ...
-
bioRxiv - Genetics 2022Quote: ... Libraries were constructed using the Lexogen QuantSeq 3′ mRNA-Seq Library Kit FWD (Lexogen, Greenland, NH) and sequenced on an Illumina NextSeq 500 producing 85 nt single-end reads (Illumina, San Diego, CA) with each plate being split in half and each half being sequenced on a single lane to achieve desirable coverage.
-
bioRxiv - Immunology 2022Quote: ... The amplicons were quantified using KAPA Library Quantitation kit (KAPA, Cape Town, South Africa) and an equimolar amount of each sample was sequenced on the MiSeq System (Illumina, San Diego, CA) with 2×150 paired-end run parameters ...
-
bioRxiv - Cancer Biology 2022Quote: ... RNA-Seq libraries were generated from 300 ng of total RNA using TruSeq Stranded mRNA Library Prep Kit and IDT for Illumina - TruSeq RNA UD Indexes (96 Indexes, 96 Samples) (Illumina, San Diego, USA), according to manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Genetics 2022Quote: ... Individual barcoded libraries were randomly multiplexed into groups of four samples using equimolar quantities and sequenced on a MiSeq using a v3 600 reagent kit (Illumina, San Diego, CA) to generate paired-end 250 bp reads ...
-
bioRxiv - Genetics 2022Quote: ... Output total RNA was depleted for ribosomal RNA and prepped for RNA-seq using the Scriptseq Complete Gold (Epidemiology) kit (Illumina, San Diego, CA). A total of ~50 ng of ribosomal depleted RNA was used as an input to transcriptome libraries ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Two independent paired-end libraries were constructed per population from these DNA pools using the Genomic DNA Sample Preparation Kit (Illumina, San Diego, CA) (technical replicates) ...
-
bioRxiv - Microbiology 2019Quote: ... we sequenced the pooled library on the Illumina MiSeq platform using 250 × 250 base pair (bp) paired-end reads (Illumina Reagent Kit v2) at the Indiana University Center for Genomics and Bioinformatics Sequencing Facility ...
-
bioRxiv - Cancer Biology 2020Quote: RNA libraries were prepared from 550ng of total RNA using the TruSeq Stranded Total RNA HT kit with Ribo-Zero Gold (Illumina, San Diego, USA) as per manufacturer’s instructions and subjected to paired end 75 sequencing on a HiSEQ4000 platform (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... and a 3 kb mate-pair library using an Illumina Nextera Mate Pair Sample Preparation kit and following the manufacturer’s protocol (Illumina, San Diego, CA, USA). Both libraries were sequenced on an Illumina HiSeq 2500 at the Bauer Core ...
-
bioRxiv - Genomics 2019Quote: ... An aliquot of each DNA sample was diluted to 0.2 ng/μl and used as input DNA to the Nextera XT DNA Library Preparation Kit (Illumina Inc. San Diego, CA), according to manufacturer’s recommendations ...
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-Seq libraries preparation and sequencing was performed by the IGA Technology Services (Udine, Italy) using the Illumina TruSeq Stranded mRNA Kit (Illumina, San Diego, CA) according to manufacturer’s instructions ...
-
bioRxiv - Microbiology 2019Quote: ... Subsequent amplicon sequencing was performed on a MiSeq DNA-sequencing platform using a 600-cycle MiSeq Reagent Kit v3 (Illumina, San Diego, CA). Sequencing yielded 5,594,739 paired end sequences ...
-
bioRxiv - Immunology 2019Quote: ... Non-stranded sequencing libraries were prepared using Illumina TruSeq RNA library kits and sequenced on an Illumina Hi Seq2500 using a SE70 protocol (Illumina, San Diego, CA). Raw sequenced reads were trimmed for adapter and bar-codes sequences and quality assessed using FastQC (http://www.bioinformatics.babraham.ac.uk/projects/fastqc/) ...
-
bioRxiv - Genomics 2019Quote: ... The barcode sequencing libraries were subjected to a final bead clean-up SPRIselect reagent and quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms; KK4824). Sequencing libraries were loaded on an Illumina sequencer with 2 × 50 paired-end kits using the following read length ...