Labshake search
Citations for Illumina :
901 - 950 of 8936 citations for Corticosterone ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2019Quote: ... double indexed libraries (Nextera XT indices) were prepared from recovered library DNA from rounds 3–5 and sequenced on a MiSeq platform (Illumina) using a v3 chip as single 151 cycle reads37 ...
-
bioRxiv - Molecular Biology 2020Quote: ... nuclei were isolated from 100,000 cells and sequencing adapters were transposed for 30 minutes at 37°C using 5 μl of TDE1 (Nextera Tn5 transposase, Illumina). After PCR and gel purification ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... TASSEL 5 GBS v2 pipeline (52) was used to perform the SNP calling of the sequence data obtained from Illumina sequencing ...
-
bioRxiv - Genetics 2021Quote: ... The bone and reference captured library pools were diluted to 1 pM with a 5% spike-in of PhiX Control V3 (Illumina) for sequencing on a NextSeq 550 (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... The resulting 10 nM pool was denatured to 10 pmol with 5% PhiX spike-in and sequenced as single-read on HiSeq 2500 (Illumina) in rapid mode for 51 cycles (plus 7 cycles index read ...
-
bioRxiv - Microbiology 2021Quote: ... Total 5 μg of RNA was used for rRNA depletion by using Ribo-Zero™ (Epicentre, Illumina, Madison, WI USA) kit and purified by using Qiagen-RNeasy miniElute (Qiagen GmbH ...
-
bioRxiv - Molecular Biology 2022Quote: ... with Forward Library primer (5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT3’) and Reverse Library primers (5’CAAGCAGAAGACGGCATACGAGATNNNNNNGTGACTGGAGTTCAGACGTGTGCTCTT CCGATC3’, where NNNNNN denotes the barcodes, e.g. Index1 is CGTGAT for Illumina sequencing). Three rounds of agarose gel purification were performed to purify the fragments of 200~650 bp using QIAquick Gel Extraction Kit (Qiagen) ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing was performed at 5 million reads/sample in single-end mode with 150 nt read length on the NextSeq 500 platform (Illumina) using a Mid output sequencing kit ...
-
bioRxiv - Neuroscience 2022Quote: ... Each pool was sequenced on the Illumina NextSeq 500 after the addition of 5% PhiX sequencing control library (FC-110-3002; Illumina) using the following settings ...
-
bioRxiv - Microbiology 2023Quote: ... a PhiX spike-in of 2.5–5% was added to the pools (PhiX sequencing control v3; Illumina FC-110- 3001). Samples were run on the Illumina NovaSeq 6000 platform (single-read 1 ×85 cycles and 6 × i7 index cycles).
-
bioRxiv - Genomics 2023Quote: ... 3) carried no SNP or indel within 50 bp in their 5’ or 3’ flanking regions (Illumina probe design requirement); and 4 ...
-
bioRxiv - Microbiology 2023Quote: ... PCR products were purified with AMPure XP purification kit and Sixteen-plexed samples were pooled in approximately equimolar amounts of 5 nM and run in a single and double index reads on a Hiseq 4000 (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... The transposon-specific primer was designed to include (from 5’ to 3’): (i) the “P5” or “P7” flow-cell annealing sequence (Illumina), (ii ...
-
bioRxiv - Developmental Biology 2023Quote: ... The samples were pooled at a concentration of 5 nM and run on an Illumina HI-SEQ 2500 sequencer (Illumina) to obtain paired-end reads of 75 bases (PE75) ...
-
bioRxiv - Genomics 2023Quote: ... We used 15 mins incubation on ice in the nuclei preparation step and the Tn5 reaction was performed in 50 μl of custom transposition buffer (10 mM Tris pH 8, 5 mM MgCl2 and 10% dimethylformamide) with 2.5 μl Tn5 transposase (Illumina, 20034197) at 37°C while mixing at 1000 rpm for 30 mins ...
-
bioRxiv - Cell Biology 2023Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95% endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Plasma was divided from maternal peripheral blood (5[mL) by centrifuging and then 600[μL (Ion Torrent) or 1.4 mL (Illumina CN500) plasma was used to extract cell-free DNA ...
-
bioRxiv - Immunology 2023Quote: ... ADT and 3’ Gexp libraries were mixed at the ratio of 1:5 and sequenced on NovaSeq 6000 sequencer (Illumina) with a configuration of 28/8/0/91-bp for cell barcode ...
-
bioRxiv - Cell Biology 2023Quote: ... 30 sec at 62°C and a final extension step of 5 min at 62°C) and sequenced using the NOVASeq platform (Illumina).
-
bioRxiv - Genomics 2023Quote: ... groups was based on 5 μg of total RNA according to the manufacturer’s protocol using the Illumina HiScanSQ Instrument (Illumina, USA) and sequenced in the same flow cell as paired-end (2 × 100 bp) ...
-
bioRxiv - Immunology 2024Quote: ... the antibody barcode library was pooled at a ratio of 1:5 with the gene expression library and sequenced on a NextSeq 2000 (Illumina) to an average depth of 34,000 reads per cell.
-
bioRxiv - Cell Biology 2024Quote: ... The hashtag cDNA and endogenous cDNA libraries were diluted to 4 nM and pooled (5% hashtag + 95 % endogenous cDNA) before being sequenced on a NextSeq2000 sequencer (Illumina).
-
bioRxiv - Genetics 2024Quote: ... The libraries were amplified for 5 cycles and sequenced in 2×75-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2024Quote: ... All samples were pooled to a final concentration of 5-10 ng/µL and sequenced on a NextSeq 500 (Illumina). The demultiplexed data was assembled and SNPs detected with Pilon software using reference genome sequences.84
-
bioRxiv - Cancer Biology 2021Quote: ... and PCR amplification (TruSeq Nano Library Preparation Kit, Illumina). Samples generated with PC v2.0 and panel v4 also had unique molecular identifier (UMI ...
-
bioRxiv - Plant Biology 2020Quote: ... Ribo-Zero kit (Epicentre, an Illumina company, Madison, WI) was used to remove rRNA from the libraries ...
-
bioRxiv - Microbiology 2020Quote: ... libraries were prepared using the Nextera XT kit (Illumina) at 1/12th reaction size with a TTP LabTech mosquito® HV liquid handling robot ...
-
bioRxiv - Genetics 2021Quote: ... rRNA was removed using the Ribo-Zero kit (Illumina) and stranded RNA-seq libraries were prepared using random hexamer and NEB directional RNA library prep kit (NEB ...
-
bioRxiv - Genomics 2021Quote: ... The TruSeq DNA Nano Sample Prep Kit v2 (Illumina) was used in subsequent steps of library preparations ...
-
bioRxiv - Molecular Biology 2021Quote: ... then treated with RiboZero Magnetic Gold (Yeast) Kit (Illumina) as described previously30 ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the NextSeq500/550 High Output v2.5 Kit (Illumina). The sequence reads were aligned against GRCh38 genome assembly using the cellranger count command of Cell Ranger (version 4.0.0 ...
-
bioRxiv - Developmental Biology 2021Quote: ... using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1096 ...
-
bioRxiv - Developmental Biology 2021Quote: ... A Nextera XT DNA Library Preparation Kit (Illumina, Inc.) was used to generate indexed 2×75bp paired-end cDNA libraries for subsequent sequencing on NextSeq 500 sequencing platform (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: ... Libraries were then generated using the Nextera kit (Illumina) and 75bp single end read-sequencing was carried out.
-
bioRxiv - Developmental Biology 2020Quote: ... using the Nextera DNA Flex library prep kit (Illumina) to create a library from full-length cDNA ...
-
bioRxiv - Genomics 2022Quote: Illumina’s TruSeq Stranded mRNA Library Prep Kit (#20020594, Illumina) was used on 500 ng of total RNA for the preparation of strand-specific sequencing libraries according to manufacturer’s guidelines ...
-
bioRxiv - Genomics 2022Quote: ... and used the TruSeq RNA Sample Preparation Kit (Illumina) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2019Quote: ... and quantified using the KAPA Library Quanti Kit (Illumina) Universal qPCR Mix (KAPA Biosystems ...
-
bioRxiv - Molecular Biology 2021Quote: ... with the TruSeq® Stranded mRNA assay kit (Illumina) employed as per manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2020Quote: ... V2×500 or V3×600 sequencing kits (Illumina, USA) with sample coverages specified in Supplementary table 1.
-
bioRxiv - Cell Biology 2022Quote: ... The TruSeq Stranded HT mRNA Sample Prep Kit (Illumina) was used in subsequent steps following the manufacturer’s protocol ...
-
bioRxiv - Developmental Biology 2022Quote: ... Libraries were prepared with TruSeq stranded mRNA kit (Illumina) and sequenced 2×125 bp on an Illumina Nextseq platform ...
-
bioRxiv - Genomics 2020Quote: Sequencing libraries were prepared with Nextera XT kit (Illumina) as per the manufacturer’s instructions but at one quarter of the recommended volumes ...
-
bioRxiv - Genetics 2019Quote: ... we used the Nextera DNA Library Preparation Kit (Illumina) to make 20 libraries with unique barcode combination (Nextera Index Kit ...
-
bioRxiv - Genomics 2019Quote: ... Clusters were generated with a cluster generation kit (Illumina), cDNAs were sequenced by synthesis ...
-
bioRxiv - Microbiology 2020Quote: ... specific sequencing Nextera XT v2 Index Kit adapters (Illumina) were annealed to the amplicons via Index PCR (Table S2 ...
-
bioRxiv - Genomics 2019Quote: ... TruSeq™DNA Sample Preparation Kit v2 (Illumina Inc.) and the KAPA Library Preparation kit (Kapa Biosystems ...
-
bioRxiv - Microbiology 2019Quote: ... and a MiSeq Reagent Kit v3 (600 cycles; Illumina). The following processing steps were then applied to forwards reads using USEARCH (v10.0.240 ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... with a Sequencing Library qPCR Quantification kit (Illumina Inc.). Sequencing was performed with two 36-cycle TruSeq SBS paired-end kits (Illumina Inc. ...
-
bioRxiv - Developmental Biology 2019Quote: ... TruSeq Stranded Total RNA LT Sample Prep Kit (Illumina) was used for library preparation starting from 500 ng of total RNA for each sample ...