Labshake search
Citations for Illumina :
851 - 900 of 9406 citations for 2'3' cyclic GAMP cGAMP ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2023Quote: ... The TruSeq Small RNA-seq preparation kit (Illumina) was used for miRNA sequencing according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using TruSeq RNA kit (Illumina) following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on a NextSeq kit (Illumina) with 75bp single-end read chemistry and 9 bp index read ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the HiSeq 3000/4000 SBS kit (Illumina). On average ...
-
bioRxiv - Microbiology 2023Quote: ... The Nextera XT DNA Library Preparation Kit (Illumina) was used to prepare the sequencing libraries ...
-
bioRxiv - Molecular Biology 2023Quote: ... Nextera XT DNA Library Prep Kit (Illumina, USA) was used to prepare the sequencing libraries ...
-
bioRxiv - Genetics 2023Quote: ... using NovaSeq 6000 S1 Reagent Kit (Illumina, 20028318). Sequencing metrics are available in Table S3.
-
bioRxiv - Cell Biology 2023Quote: ... using a NovaSeq 6000 SP Reagent Kit (Illumina). Eight to ten biological replicates were generated for each sample ...
-
bioRxiv - Developmental Biology 2023Quote: ... using the kit TruSeq Stranded mRNA by Illumina.
-
bioRxiv - Molecular Biology 2023Quote: ... using the HiSeq 3000/4000 SBS Kit (Illumina). An average of 61 million paired reads were generated per sample and the percent of mRNA bases averaged 79% ...
-
bioRxiv - Cancer Biology 2023Quote: ... with the NovaSeq 6000 S4 Reagent Kit (Illumina). On average ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the HiSeq 3000/4000 SBS Kit (Illumina). An average of 27 million paired reads was generated per sample.
-
bioRxiv - Genetics 2023Quote: ... NEXTflex™ ChIP-Seq Barcodes kit (Illumina compatible) (BIOO Scientific Corp. ...
-
bioRxiv - Immunology 2023Quote: ... we used the TruSeq Ribo Profile kit (Illumina) to process them according to the manufacturer’s instructions ...
-
bioRxiv - Genetics 2023Quote: ... and MiSeq Reagent Nano Kit v2 (Illumina, #15036714), at a concentration of 10pM ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation with Ribo-Zero Plus kit (Illumina, #20040529). Pooled libraries were then run on a NextSeq 550 High Output flow cell 2×75bp up to 800M reads followed by NextSeq 550 Medium Output flow cell 2×75bp up to 260M reads ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Library preparation (TruSeq stranded mRNA Kit by Illumina) and sequencing (RNA-Seq NovaSeq6000 S4 ...
-
bioRxiv - Plant Biology 2023Quote: ... and NextSeq 500/550 High Output Kit (Illumina). Reads were mapped as described and differential gene expression analysis was performed with edgeR (Robinson et al. ...
-
bioRxiv - Cell Biology 2023Quote: ... using a NovaSeq 6000 SP Reagent Kit (Illumina) to generate 108-nucleotide single-end reads ...
-
bioRxiv - Bioengineering 2024Quote: ... The Stranded Total RNA Library Prep Kit (Illumina) was used to create the sequencing libraries ...
-
bioRxiv - Cell Biology 2024Quote: ... 2.5 μl Transposase enzyme (Illumina Nextera kit, 15028252) and 22.5 μl nuclease-free water in a total of 50 μl per reaction for 1 hour at 37°C ...
-
bioRxiv - Neuroscience 2024Quote: ... using the TruSeq Stranded mRNA HT Kit (Illumina) according to the manufacturer’s instructions.
-
bioRxiv - Cancer Biology 2024Quote: ... using the HiSeq 3000/4000 SBS Kit (Illumina). An average of 100 million paired reads was generated per sample ...
-
bioRxiv - Cell Biology 2024Quote: ... using the NovaSeq 6000 SX Reagent Kit (Illumina). An average of 24 million paired reads was generated per sample ...
-
bioRxiv - Microbiology 2024Quote: ... Ligation with Ribo-Zero Plus kit (Illumina, USA) following the manufacturer’s instructions and sequencing carried out on the Illumina NovaSeq™ 6000 (Illumina ...
-
bioRxiv - Genomics 2024Quote: ... and Nextera Mate Pair Sample Preparation kit (Illumina), respectively ...
-
bioRxiv - Genomics 2024Quote: ... paired end 2X150 kit (Illumina, San Diego, CA). The resulting raw sequence was only trimmed for adaptors ...
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were collected and subject to tagmentation at 37 °C for 30 minutes in adjusted tagmentation buffer (2x TD Tagment buffer + Digitonin 0.01% + 5 ul of TDE Tagment DNA enzyme from Illumina). Reaction was stopped with 0.2% SDS and DNA was collected using Qiaquick PCR purification columns and eluted in 10 μl 10 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2019Quote: ... We tagmented 5 ng of cDNA using 1 uL Nextera Tagment DNA Tn5 transposase (Illumina, San Diego, CA, 15027916) in a 10 uL tagmentation mix for 10 minutes at 55 °C.
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Genomics 2022Quote: ... 5 μl of Index primer (both provided in NEBNext Multiplex Oligos for Illumina Index Primers Sets 1 and 2), and 25 μl NEBNext Ultra II Q5 Master Mix (PCR cycling conditions ...
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).