Labshake search
Citations for Illumina :
801 - 850 of 8936 citations for Testosterone ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2023Quote: ... and Nextera™ XT Library Prep kit (Illumina). Samples were sequenced using a NextSeq 5000 (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... ‘human/mouse’ and ‘bacteria’ Ribo-Zero kits (Illumina). RNA quality and concentration were verified by BioAnalyzer (Agilent Technologies ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the novaseq 6000 Reagent Kits (Illumina, Inc.) according to the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2023Quote: ... The TruSeq Small RNA-seq preparation kit (Illumina) was used for miRNA sequencing according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries were prepared using TruSeq RNA kit (Illumina) following manufacturer instructions ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on a NextSeq kit (Illumina) with 75bp single-end read chemistry and 9 bp index read ...
-
bioRxiv - Cancer Biology 2023Quote: ... using the HiSeq 3000/4000 SBS kit (Illumina). On average ...
-
bioRxiv - Microbiology 2023Quote: ... The Nextera XT DNA Library Preparation Kit (Illumina) was used to prepare the sequencing libraries ...
-
bioRxiv - Developmental Biology 2023Quote: ... using the kit TruSeq Stranded mRNA by Illumina.
-
bioRxiv - Cancer Biology 2023Quote: ... with the NovaSeq 6000 S4 Reagent Kit (Illumina). On average ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the HiSeq 3000/4000 SBS Kit (Illumina). An average of 27 million paired reads was generated per sample.
-
bioRxiv - Immunology 2023Quote: ... we used the TruSeq Ribo Profile kit (Illumina) to process them according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2023Quote: ... using the HiSeq 3000/4000 SBS Kit (Illumina). An average of 61 million paired reads were generated per sample and the percent of mRNA bases averaged 79% ...
-
bioRxiv - Microbiology 2023Quote: ... and Kapa Library Quantification Kit (Illumina, United States), and a quality check of the samples was conducted using the 4150 TapeStation system (Agilent Technologies ...
-
bioRxiv - Cell Biology 2023Quote: ... using a NovaSeq 6000 SP Reagent Kit (Illumina). Eight to ten biological replicates were generated for each sample ...
-
bioRxiv - Genetics 2023Quote: ... using NovaSeq 6000 S1 Reagent Kit (Illumina, 20028318). Sequencing metrics are available in Table S3.
-
bioRxiv - Plant Biology 2023Quote: ... and NextSeq 500/550 High Output Kit (Illumina). Reads were mapped as described and differential gene expression analysis was performed with edgeR (Robinson et al. ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Library preparation (TruSeq stranded mRNA Kit by Illumina) and sequencing (RNA-Seq NovaSeq6000 S4 ...
-
bioRxiv - Cell Biology 2023Quote: ... using a NovaSeq 6000 SP Reagent Kit (Illumina) to generate 108-nucleotide single-end reads ...
-
bioRxiv - Microbiology 2023Quote: ... Ligation with Ribo-Zero Plus kit (Illumina, #20040529). Pooled libraries were then run on a NextSeq 550 High Output flow cell 2×75bp up to 800M reads followed by NextSeq 550 Medium Output flow cell 2×75bp up to 260M reads ...
-
bioRxiv - Microbiology 2024Quote: ... or the Ribo-Zero rRNA removal Kit (Illumina). The mRNA was fragmented and primed using NEBNext First Strand Synthesis Reaction Buffer and NEBNext Random Primers ...
-
bioRxiv - Genetics 2023Quote: ... NEXTflex™ ChIP-Seq Barcodes kit (Illumina compatible) (BIOO Scientific Corp. ...
-
bioRxiv - Genetics 2023Quote: ... and MiSeq Reagent Nano Kit v2 (Illumina, #15036714), at a concentration of 10pM ...
-
bioRxiv - Neuroscience 2024Quote: ... using the HiSeq 3000/4000 SBS Kit (Illumina) for PE100 reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... The TruSeq Stranded mRNA Library Prep kit (Illumina) was used for library preparation ...
-
bioRxiv - Plant Biology 2024Quote: ... The Ribo-Zero Gold rRNA removal kit (Illumina) was used for rRNA depletion ...
-
bioRxiv - Cancer Biology 2024Quote: ... using the HiSeq Rapid SBS Kit v2 (Illumina). Libraries were also run on a NextSeq 500 in a 150bp/150bp paired end run ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Illumina TruSeq Stranded mRNA library preparation Kit (Illumina) and NextSeq 500 Mid Output Kit PE75 (120 M reads ...
-
bioRxiv - Cell Biology 2024Quote: ... Ribo-Zero Plus stranded library preparation kit (Illumina) was used to generate libraries from a total of 1µg RNA for each sample ...
-
bioRxiv - Microbiology 2024Quote: ... TruSeq Stranded mRNA Library Prep Kit from Illumina was applied to prepare the cDNA libraries ...
-
bioRxiv - Cancer Biology 2024Quote: ... the Stranded Total RNA Library Prep Kit (Illumina) was used ...
-
bioRxiv - Molecular Biology 2024Quote: ... with MiSeq Reagent Kit v2 (500 cycles; Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... on Thermo Fisher Scientific’s Quantstudio 5 before multiplex pooling and sequencing a 2×100 flow cell on the NovaSeq platform (Illumina) at the Collaborative Sequencing Center.
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were collected and subject to tagmentation at 37 °C for 30 minutes in adjusted tagmentation buffer (2x TD Tagment buffer + Digitonin 0.01% + 5 ul of TDE Tagment DNA enzyme from Illumina). Reaction was stopped with 0.2% SDS and DNA was collected using Qiaquick PCR purification columns and eluted in 10 μl 10 mM Tris ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2019Quote: ... We tagmented 5 ng of cDNA using 1 uL Nextera Tagment DNA Tn5 transposase (Illumina, San Diego, CA, 15027916) in a 10 uL tagmentation mix for 10 minutes at 55 °C.
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...