Labshake search
Citations for Illumina :
801 - 850 of 2148 citations for 1 Benzyl 4 5 benzyloxy 6 methoxy 1 indanone 2 ylidenyl methylpiperidine since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: ... The clustered flowcell is then sequenced with a 30b read 1 and an 11b index read using a HiSeq SBS v4 50 cycle kit (Illumina) following the manufacturer’s recommendations.
-
bioRxiv - Plant Biology 2023Quote: ... The RNA-seq libraries were constructed with 1 μg of RNA per sample by following the manual of TruSeq Stranded mRNA kit (Illumina). The RNA-seq libraries were sequenced on an Illumina NovaSeq 6000 or an Illumina HiSeq 4000 sequencer.
-
bioRxiv - Developmental Biology 2023Quote: ... Nuclei were mixed with 50 µl of transposition reaction mix containing Tagment DNA Enzyme 1 (Nextera DNA Library Preparation Kit, Illumina). The transposition reaction was carried out at 37°C and 600rpm for 30 min ...
-
bioRxiv - Physiology 2023Quote: ... 1 ng of amplified cDNA was used to generate barcoded libraries using the Nextera XT DNA library preparation kit (Illumina). Basically ...
-
bioRxiv - Genomics 2023Quote: ... All cDNA libraries were sequenced on an Illumina NextSeq 500 instrument with 1.45 pM input and 1% PhiX control library spiked in (Illumina, USA) targeting 30-40 Million reads pairs per sample.
-
bioRxiv - Genomics 2024Quote: ... The filtered read 1 was then mapped on the mm10 was mapped on the mm10 reference genome (source: Illumina igenomes) using the STAR package (v 2.7.9a ...
-
bioRxiv - Microbiology 2024Quote: ... using 28 + 91 -bp paired-end reads and 8-bp Index 1 reads with a 100-cycle kit (Illumina, 20028400).
-
bioRxiv - Plant Biology 2024Quote: ... A total of 1 mg of lyophilized tissue was processed with the MasterPure Complete DNA and RNA purification kit (Illumina) according to the protocol provided by the supplier ...
-
bioRxiv - Cancer Biology 2024Quote: ... and were sequenced on an Illumina NovaSeq6000 system or on an Illumina HiSeq 4000 system (Data S2) with a 1% spike-in of PhiX control library (Illumina).
-
bioRxiv - Genomics 2024Quote: ... Library amplification was carried out with Integrated DNA Technologies (IDT) for Illumina UD Indexes (96x, Plate A, Set 1, Illumina). Library size selection was performed to remove fragments below 180 bp and above 700 bp using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were prepared from 1 ng of genomic DNA using a reduced-volume dual-barcoding Nextera (Illumina, San Diego, CA) protocol as previously described (Erickson et al ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were generated from 1 μg of total RNA using a TruSeq Stranded Total RNA Library Prep Human/Mouse/Rat (48 Samples) (Illumina) or KAPA mRNA HyperPrep Kit (Roche ...
-
bioRxiv - Developmental Biology 2024Quote: ... Bisulfite-treated DNA (1 µg) was pipetted onto an Illumina Infinium Mouse Methylation-12v1-0 BeadChip (Illumina, CA, United States) that was run on an Illumina iScan System (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The different libraries were pooled according to the effective concentration and the target amount of data – 6 Gb raw data per sample – and were sequenced by the Illumina NovaSeq 6000 (Illumina Inc., San Diego, CA, USA). Paired-end 150bp reads were generated.
-
bioRxiv - Pathology 2021Quote: ... with the libraries clustered at 12-15pM and mixed with 5% PhiX genomic DNA (Illumina).
-
bioRxiv - Molecular Biology 2020Quote: ... Samples were diluted and mixed with 5-20% phiX control v3 (Illumina FC-110-3001) and sequenced with oSK326 for read 1 and oSK324 for the index read.
-
bioRxiv - Cell Biology 2023Quote: ... and 5-day deligated samples were sequenced (the ligated sample was sequenced on the Illumina Nextseq500 and all others were sequenced on the Illumina Nextseq2000) ...
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Microbiology 2023Quote: ... all libraries were spiked with 5% PhiX Control v3 (Illumina, Catalog No. FC-110-3001). The NCBI Genbank accession number for the raw sequencing data reported here is PRJNA999749.
-
bioRxiv - Genomics 2024Quote: ... were dual-indexed using differing barcode indexes both for the forward (5’ P5 Illumina adapter) and reverse oligos (3’ P7 Illumina adapter) ...
-
bioRxiv - Cell Biology 2024Quote: ... 1,6 pM of libraries with 5% PhiX was then loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Genomics 2020Quote: ... De-multiplexing of RNA-Seq reads was conducted using bcl2fastq v.2 (Illumina). Both DNA-Seq and RNA-Seq reads were submitted to FastQC 51 for quality validation.
-
bioRxiv - Molecular Biology 2021Quote: ... 2 × 36 base paired-end sequencing was performed with a NextSeq500 sequencer (Illumina) by Tsukuba i-Laboratory LLP (Tsukuba ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). Reads were mapped using STAR (v 2.5.2b ...
-
FOXO dictate initiation of B cell development and myeloid restriction in common lymphoid progenitorsbioRxiv - Immunology 2022Quote: ... Libraries were sequenced paired-end (2×50 cycles) on the Illumina platform (Illumina). To obtain differential ATACseq peaks ...
-
bioRxiv - Immunology 2021Quote: ... Sequencing had been performed by a 300*2 paired-end kit by Illumina MiSeq ...
-
bioRxiv - Genetics 2021Quote: ... and subjected to 2 × 50-bp paired-end sequencing on Hiseq XTen (Illumina).
-
bioRxiv - Neuroscience 2021Quote: ... The libraries were sequenced paired ended (2×75bp) on the NextSeq500 instrument (Illumina) to an average of at least 33 million reads ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were sequenced 2 * 50+8+16 bp on a HiSeq2500 sequencer (Illumina). RNA-seq data were processed according to Doyle et al ...
-
bioRxiv - Microbiology 2021Quote: ... An Illumina MiSeq Platform (2×300 cycles; Illumina Inc., San Diego, CA, USA) was used for a paired-end sequencing run ...
-
bioRxiv - Systems Biology 2020Quote: ... a 2 x 300 bp paired end library (Illumina Nextera XT DNA kit) was sequenced on a MiSeq ...
-
bioRxiv - Microbiology 2020Quote: ... 2 μg of RNA were treated with “TruSeq RNA sample preparation kit” (Illumina) combined with a specific strand labeling using dUTPs [36] ...
-
bioRxiv - Molecular Biology 2020Quote: ... Paired-end (150 base pairs × 2) sequencing with the NovaSeq 6000 platform (Illumina) was outsourced to Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... and 2.5μL (20μM) each of 2 indexed primers (Illumina TruSeq Combinatorial Dual (CD) index adapters ...
-
bioRxiv - Plant Biology 2022Quote: ... we obtained 26–30 × pair-end sequencing reads (150 bp × 2) from Illumina HiSeq 2500 (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Pair-ended 2×75 bp sequencing was performed on the NextSeq 500 (Illumina) at Core Unit Systems Medicine ...
-
bioRxiv - Cell Biology 2022Quote: ... WGS paired-end (PE) reads with 2×150bp configuration were obtained from Illumina HiSeq platform and processed using SAMtools (v1.2 ...
-
bioRxiv - Immunology 2022Quote: ... Sequencing was carried out on a Novaseq6000 S2 2×50bp flow cell (Illumina) utilizing the Chromium single-cell 5′ gene expression library preparation (10X Genomics) ...
-
bioRxiv - Genomics 2022Quote: ... SW-8046-2) from libraries prepared using the Nextera XT DNA kit (Illumina, Inc ...
-
bioRxiv - Cell Biology 2022Quote: ... paired-end (2 × 150 bp) sequencing with the Hiseq 4000 platform (Illumina, USA). The resulting FASTQ files were then aligned against the reference genome (Ankara C9 genome) ...
-
bioRxiv - Microbiology 2021Quote: ... and paired-end sequencing (2 x 150 bp) was performed using MiniSeq (Illumina). Illumina paired-end reads were mapped onto the on-site assembly sequences ...
-
bioRxiv - Microbiology 2020Quote: ... Paired-end sequencing (2×250 bases) was performed on a HiSeq 2500 (Illumina) using the HiSeq Rapid SBS Kit v2 (500 cycle ...
-
bioRxiv - Physiology 2020Quote: ... Paired-end (2 × 75 bp) sequencing was performed on the HiSeq4000 system (Illumina). Sequencing data were aligned to the human reference genome using the Burrows-Wheeler Aligner (Li & Durbin ...
-
bioRxiv - Cell Biology 2021Quote: ... LT-PTC and pUC using TruSeq mRNA sample prep kit v.2 (Illumina). Sequence alignment and RNA-Seq analysis ...
-
bioRxiv - Bioengineering 2021Quote: ... followed by sequencing using a 2×300 paired end reagent kit (v3, Illumina). For the 3-segment interrogation (Fig ...
-
bioRxiv - Biochemistry 2021Quote: ... primarily as paired end 2×151 read multiplex runs on MiSeq platform (Illumina). We used the ShapeMapper2 algorithm 79 to determine the mutation frequency in both chemically modified (5NIA and DMS treated ...
-
bioRxiv - Genomics 2020Quote: ... The libraries were then prepared and sequenced (2 × 75 bp, paired-end Illumina NextSeq with the first ten bases acting as tags) ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were sequenced pair-end (2×50 cycles) on the Illumina platform (Illumina). Reads were trimmed (using Trim Galore v0.4.1) ...
-
bioRxiv - Microbiology 2021Quote: All SARS-CoV-2 stocks were deep sequenced on a MiSeq platform (Illumina).
-
bioRxiv - Immunology 2020Quote: ... Sequencing is performed using the 2*300 MiSeq Reagent Kit v3 (Illumina, Inc.).