Labshake search
Citations for Illumina :
751 - 800 of 1399 citations for rno mir 32 RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2021Quote: ... and 200 pg of material was used to generate final sequencing libraries with the NexteraXT kit and NexteraXT Indexing primers (Illumina, Inc) using 12 cycles of PCR amplification ...
-
bioRxiv - Microbiology 2020Quote: ... The forward and reverse primers were designed to contain an Illumina® overhang adapter sequence (Illumina®; San Diego, CA, USA) in order to anneal them to primers containing the Illumina® adaptors plus the 8 bp identifier indices ...
-
bioRxiv - Microbiology 2021Quote: Purified PCR products were given unique dual indexes at the 5’ end using the Nextera XT Index Kit v2 index primers (Illumina, USA). To attach the index primers ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genomics 2021Quote: ... and 8.8 µl of paired i7 and i5 Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001) were added to each Tagmentation reaction ...
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Molecular Biology 2023Quote: ... for 1[h at 60°C and was subsequently PCR amplified using the primers 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTC-3′ and 5′-CAAGCAGAAGACGGCATACGAGATJJJJJJGTGACTGGAGTTCAGACGTGTG-3′(where Js indicates the 6-mer index sequence for Illumina sequencing).
-
bioRxiv - Microbiology 2024Quote: ... were attached to overhang adaptors (Forward overhang:5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAG, and Reverse overhang:5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAG) at the 5’ end of the respective primer sequences (Illumina, Inc.) and used to amplify the region of interest.
-
bioRxiv - Biochemistry 2024Quote: As template a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina primers). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Genetics 2020Quote: ... Libraries were made according to the manufacturer’s directions for the TruSeq Stranded mRNA LT Sample Prep Kit – sets A and B (Illumina, Cat. No. RS-122-2101 and RS-122-2102). Resulting short fragment libraries were checked for quality and quantity using the Bioanalyzer (Agilent ...
-
bioRxiv - Synthetic Biology 2022Quote: ... Indexes were added to the amplified DNA using i5 and i7 primers from the Nextera XT Index Kit (Illumina # FC-131-1002). Indexed samples were loaded into a MiSeq Reagent Kit v3 600-cycle (Illumina # MS-102-3003 ...
-
bioRxiv - Microbiology 2020Quote: ... with library preparation and sequencing performed using primer pair 515F and 806R in 300 bp paired end run on an Illumina MiSeq (Illumina, San Diego). Sequencing data was analyzed using QIIME2 version 2019.7.0 (25 ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl each of P7 and P5 Nextera XT Index Kit v2 index primers (Illumina Catalogue numbers FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Genetics 2020Quote: ... 0.02 µM of specific adapters for the Illumina technology (containing the barcode sequences and complementary to the Illumina ™ primers for sequencing) were connected to the fragments ends generated in the digestion ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and 12.5 pmol each of the following Illumina primers: 5′-AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCG ATCT and 5′-CAAGCAGAAGACGGCATACGAGATCGGTCTCGGCATTCCTGCTGAACCGCTCT TCCGATCT (the underlined parts will hybridize to the two Illumina flowcell oligos). Temperature cycling consisted of 72 ◻C for 5 min ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL each of P7 and P5 of Nextera XT Index Kit v2 index primers (catalogue No. FC-131-2001 to 2004; Illumina, Cambridge, UK) were also added to each well ...
-
bioRxiv - Microbiology 2022Quote: Amplicon libraries were prepared according to (16) using published 16S and 18S rRNA gene primers (Table S1) and by sequencing via the MiSeq platform (Illumina Inc., USA). Raw sequence reads were processed following a bioinformatic pipeline in Deng et al ...
-
bioRxiv - Genetics 2023Quote: ... We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles, Tm 65 °C). We then performed a bead cleanup ...
-
bioRxiv - Bioengineering 2023Quote: ... The PCR products were subjected to sequencing library construction using the TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, San Diego, CA, USA). The libraries were loaded on a NovaSeq 6000 system (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... After a post-capture PCR (four amplification cycles using Illumina PE PCR 1.0 and PE PCR 2.0 primers ...
-
bioRxiv - Microbiology 2021Quote: ... by 7 cycles PCR (16S Metagenomic Sequencing Library Preparation, Illumina). The amplicon libraries were purified using Agencourtusing the Agencourt AMPure XP system (Beckman) ...
-
bioRxiv - Cancer Biology 2020Quote: ... PCR products were then quantified and sequenced using MiSeq (Illumina).
-
Genomic bases of insularity and ecological divergence in barn owls (Tyto alba) of the Canary IslandsbioRxiv - Evolutionary Biology 2022Quote: ... and individually tagged 100bp TruSeq DNA PCR-free libraries (Illumina) were prepared according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2022Quote: ... PCR amplification was performed in a 48 well plate (Illumina) on an Eco machine (Illumina) ...
-
bioRxiv - Cancer Biology 2021Quote: ... PCR amplicons were then sequenced on a NextSeq 500 (Illumina). Guide scores were calculated as median log2 fold change in the abundance between the initial and final population of that sgRNA similar to standard CRISPR screens ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... We used a Truseq DNA PCR-free LT kit (Illumina) for library preparation ...
-
bioRxiv - Cell Biology 2019Quote: ... The PCR-amplified samples were sequenced on a HiSeq2500 (Illumina) at the Biomedical Sequencing Facility (CeMM/MUW).
-
bioRxiv - Cell Biology 2022Quote: ... PCR amplicons were purified and sequenced on a MiSeq (Illumina). Sequencing reads were mapped and the abundance of each sgRNA was measured ...
-
bioRxiv - Molecular Biology 2022Quote: ... PCR adapters from the Illumina Nextera DNA prep kit (Illumina) were selected and added to each sample along with PCR master mix ...
-
bioRxiv - Microbiology 2022Quote: ... Purified PCR products were then sequenced on a HiSeq400 (Illumina) with single end 100 bp reads at a minimum read depth of 5 million reads/sample.
-
bioRxiv - Cell Biology 2023Quote: ... Amplified and gel purified PCR products were sequenced by Illumina HiSeq (Azenta) ...
-
bioRxiv - Genomics 2023Quote: ... TruSeq® DNA PCR-Free Sample Preparation Kit (Illumina, USA) was used as per the manufacturer’s protocol for sequencing library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... PCR adapters from the Illumina Nextera DNA prep kit (Illumina) were selected and added to each sample along with PCR master mix ...
-
bioRxiv - Microbiology 2023Quote: ... PCR-enriched and barcoded with unique dual indexes (Illumina, 20027213) using six PCR cycles ...
-
bioRxiv - Cancer Biology 2024Quote: ... PCR products were sequenced on a HiSeq 4000 instrument (Illumina) at 50bp reads to a depth of 30M reads per sample.
-
bioRxiv - Microbiology 2024Quote: ... After qRT-PCR (KAPA Library Quantification Kit Illumina® Platforms) to determine TraDIS library concentration ...
-
bioRxiv - Developmental Biology 2020Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 pM and sequencing configuration as following ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Genomics 2019Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using custom ReadOne primer (IDT) and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 nM ...
-
bioRxiv - Genetics 2019Quote: ... total RNA from cochleae was reverse transcribed with random primers after ribo-depletion using a TruSeq library kit (15031048 Rev. C, Illumina, San Diego, CA), and 2×93bp sequenced on an Illumina HiSeq1500 instrument ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2020Quote: The V1 and V2 region of the 16S rRNA gene were amplified using universal bacterial primers 27F and 355R (Rodriguez-Lanetty et al. 2013) with Fluidigm CS1 and CS2 adapters (Illumina, San Diego, CA). PCR was conducted with the following reaction conditions ...
-
bioRxiv - Molecular Biology 2022Quote: ... cDNA libraries were constructed and amplified using random primers according to the manufacturer’s instructions (Illumina TruSeq RNA sample preparation guide v2 for Illumina paired-end multiplexed sequencing). For sequencing ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Neuroscience 2021Quote: ... a forward primer 5′-CTT TCC CTA CAC GAC GCT CTT CCG ATC TAC GGR AGG CAG CAG-3 (28-nt Illumina adapter (in bold) followed the 14 nt broad range bacterial primer 343F ...
-
bioRxiv - Microbiology 2020Quote: ... the V3–V4 region of bacterial 16S rRNA genes was sequenced using primers 341F-806R [25] with MiSeq technology (Illumina, San Diego, CA). Internal company standards worked as expected (Supplementary Methods) ...
-
bioRxiv - Immunology 2020Quote: ... PCR amplification and index incorporation were performed in a 50 μl reaction containing 5 μl of forward and reverse index primers (Illumina Nextera Index Kit), 15 μl NPM ...
-
bioRxiv - Genomics 2022Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Physiology 2022Quote: ... The hypervariable regions V3-V4 of the 16S rRNA coding gene were amplified using Illumina primers (fw: CCTACGGGNGGCWGCAG, rev: GACTACHVGGGTATCTAATCC) and sequencing (2 × 300 bp paired-end) was carried out on the MiSeq platform (Illumina, San Diego, California) with a coverage of 50k reads ...