Labshake search
Citations for Illumina :
751 - 800 of 831 citations for Who Coplanar & Mono Ortho Pcb + Pcb 170 & Pcb 180 13C12 99% 20 Ng Ml In N Nonane since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... and libraries were constructed by using 600 ng of total RNA from each sample and utilizing a TruSeqV2 kit from Illumina (Illumina, San Diego, CA) following the manufacturer’s suggested protocol ...
-
bioRxiv - Bioengineering 2024Quote: Barcoded stranded mRNA-seq libraries were prepared from total RNA (∼200 ng) using the Illumina TruSeq stranded mRNA Sample Preparation v2 Kit (Illumina, San Diego, CA, USA) implemented on the liquid handling robot Beckman FXP2 ...
-
bioRxiv - Cancer Biology 2021Quote: ... Libraries were pooled and sequenced with 75bp single-end sequencing to a depth of 20 × 106 reads per sample on a NextSeq500 (Illumina). Raw sequencing reads were demultiplexed using bcl2fastq (v2.17.1.14 ...
-
Phenotypic and molecular evolution across 10,000 generations in laboratory budding yeast populationsbioRxiv - Evolutionary Biology 2020Quote: ... Libraries were sequenced to an average depth of 20-fold (haploids) or 40-fold (diploids) coverage using a Nextseq 500 (Illumina).
-
bioRxiv - Synthetic Biology 2019Quote: ... and a 10%-20% PhiX was spiked in as a control (PhiX is a genomic DNA sample provided by Illumina).
-
bioRxiv - Genetics 2019Quote: Raw reads were preprocessed with cutadapt v1.15 26 to trim potential low quality bases (-q 20 -m 25) and potentially remaining sequencing adapters (-a and -A option with Illumina TruSeq adapter sequences according to the cutadapt documentation ...
-
bioRxiv - Cancer Biology 2022Quote: ... The nucleic were further resuspended in transposition mix (2X TD buffer, 1X PBS, Digitonin 0.01%, tween 20 0.1%, NFW 5ul, and Illumina transposase 2.5ul). Mixing ...
-
bioRxiv - Bioengineering 2022Quote: ... libraries were pooled at a ratio of 80% cellular RNA to 20% oligonucleotide barcoded antibodies and sequenced with NextSeq 1000/2000 kit (Illumina) using the following read length ...
-
bioRxiv - Microbiology 2020Quote: ... the sequencing protocol developed by Persson and co-workers (6,14) was adapted to the deep amplicon sequencing protocol provided by Illumina (20). The modified primers are shown in Table 1 ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were sequenced to obtain more than 20 million 100 × 100 bp paired-end reads (S4 P200 flow cell and sequencing Kit; Illumina) mapping uniquely to mouse mm10 mRNA reference.
-
bioRxiv - Genomics 2021Quote: ... The final libraries were then pooled together (15-20 at a time) and sequenced using the NextSeq 500/550 kit High Output Kit v2.5 (Illumina 20024906). The Illumina output files were converted to fastq format using bcl2fastq (v2.20.0.422 ...
-
bioRxiv - Genomics 2022Quote: ... Library preparation of genomic DNA was done using the LITE pipeline as described previously (20) and sequencing was performed using Nextseq (Illumina) with a Mid Output Flowcell (NSQ® 500 Mid Output KT v2) ...
-
bioRxiv - Molecular Biology 2022Quote: ... Libraries were sequenced to a depth of 20 million paired-end 2×150bp reads each on the NovaSeq 6000 (Illumina) at University of Colorado Genomics and Microarray Core.
-
bioRxiv - Cell Biology 2022Quote: Sequencing libraries were prepared by polyA selection for mRNA and sequenced to a depth of 20-30 Mio reads (HiSeq 4000 2 × 150 paired-end configuration, Illumina). Sequence reads were trimmed to remove possible adapter sequences and nucleotides with poor quality using Trimmomatic v.0.36 ...
-
bioRxiv - Cancer Biology 2023Quote: ... nuclei pelleted in ATAC-wash-resuspension buffer and resuspended in transposition mix (2X TD buffer, 1X PBS, Digitonin 0.01%, tween 20 0.1%, NFW 5ul, and Illumina transposase 2.5ul). Libraries were PCR-amplified using the NEBNext Hi-Fidelity PCR Master Mix and Integrated DNA Technologies (IDT ...
-
bioRxiv - Systems Biology 2023Quote: ... a 20 bp placeholder barcode sequence (GGCACTGTAGTCGATAGCCT; bait barcode) and an SP1 Illumina primer binding site (Illumina, San Diego, CA) was cloned in pRS41643 digested with KpnI-HF (New England Biolabs ...
-
bioRxiv - Genomics 2024Quote: ... Paired-end (150-bp) sequencing of each library (approx. 20 million reads per library) was then performed on the NextSeq 550 platform (Illumina). All library preparation and sequencing procedures were carried out by the Analytical Facility at QIMRB.
-
bioRxiv - Systems Biology 2023Quote: ... the final library was diluted to 20 nM with HT1 buffer and PhiX control v3 (20%, v/v) and 600 µL was loaded onto a MiSeq v2 (500 cycles) reagent cartridge (Illumina). The resulting sequences were uploaded to Illumina Sequence Hub and downloaded using BaseSpace Sequence Hub Downloader (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... CUT&RUN libraries (10–20 Mio reads per sample and 1/3 of reads for the controls) were sequenced on a NovaSeq 6000 (Illumina) paired end 100 bp at the Deep Sequencing Facility (Max Planck Institute for Immunobiology and Epigenetics ...
-
bioRxiv - Neuroscience 2024Quote: ... sequencing adaptors P5 and P7 were introduced following the 10xGenomics dual-index setup: Eluted PCR product was added to library PCR mix (50% KAPA, 10% Betaine, 20% primer Dual index (Illumina)) ...
-
bioRxiv - Microbiology 2022Quote: ... Libraries were constructed from 300 ng of total RNA from sample provided by our laboratory using the TruSeq® Stranded Total RNA Library Prep (Illumina, Inc. San Diego, CA) following the recommended protocol ...
-
bioRxiv - Genomics 2020Quote: ... Further sample QC was performed by Illumina to ensure that the concentration of the DNA was > 30 ng/μl and that every sample generated high quality genotyping results (Illumina Infinium Human Core Exome microarray). Samples with a repeated array genotyping call rate < 0.99 ...
-
bioRxiv - Genetics 2019Quote: Genomic DNA of three samples (mother, father and patient) was enriched by using the TruSight One (TSO) Next-Generation Sequencing (NGS) Panel (Illumina, Inc. San Diego, CA, USA), which includes 125,395 probes targeting a 12-Mb region spanning ~62,000 target exons of 4,811 genes ...
-
bioRxiv - Cancer Biology 2020Quote: ... A sequencing library was constructed using 100 ng of total RNA and a TruSeq RNA Access Library Prep Kit (Illumina, Inc., San Diego, CA, USA), according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2019Quote: ... Five paired-end libraries were prepared using 1 ng of extracted DNA and MiSeq Technology with the paired-end method and the Nextera XT kit (Illumina Inc., San Diego, CA, USA). DNA was fragmented ...
-
bioRxiv - Cancer Biology 2020Quote: ... the genomic DNA extracted from whole mononuclear cells from fresh BM aspirates underwent amplicon-based targeted NGS analysis on a MiSeq sequencer (Illumina Inc., San Diego, CA, USA), as described previously52 ...
-
bioRxiv - Genomics 2022Quote: Genomic libraries were prepared from 1 ng of high-quality genomic DNA using the Nextera DNA Flex Library Prep kit (now called Illumina DNA Prep, Illumina C.A., USA), following the manufacturer instructions ...
-
bioRxiv - Immunology 2023Quote: ... RNA libraries were prepared from a starting quantity of 100 ng high quality RNA using the TruSeq RNA Library Prep Kit v2 (Illumina Inc., San Diego, CA, USA). Individually barcoded RNA-seq libraries were pooled in equimolar quantities and the quantity and quality of the final pooled libraries (two different pools in total ...
-
bioRxiv - Immunology 2023Quote: ... RNA libraries were prepared from a starting quantity of 100 ng high quality RNA using the TruSeq RNA Library Prep Kit v2 (Illumina Inc., San Diego, CA, USA). All RNA samples used for transcriptomic analysis (n = 6 per group ...
-
bioRxiv - Genetics 2021Quote: ... The permeabilized myonuclei were tagmented with tagmentation mixture optimized for use on a myofiber (20 µL Tagment DNA Buffer (TD Buffer) (Illumina, 20034197), 13.3 µL PBS ...
-
bioRxiv - Molecular Biology 2021Quote: ... Sample libraries (20 nM) were subjected to multiplex next generation sequencing using an Illumina HiSeq4000 (Illumina Inc.; San Diego, CA, USA). Quality control on raw reads was performed using FASTQC ...
-
bioRxiv - Microbiology 2019Quote: ... containing 20% phiX DNA was denatured and sequenced (2 × 250 nt) on an Illumina MiSeq instrument (Illumina Inc, San Diego, CA) using a v2 500 cycle kit ...
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Neuroscience 2021Quote: ... libraries were pooled using a final concentration of 20 pM and subjected to paired-end sequencing using Illumina HiSeq 2500 (Illumina, USA) platform and HiSeq Paired-End Cluster Kits v4.
-
bioRxiv - Genomics 2022Quote: ... pH 7.4, 5 mM MgCl2, 10% dimethyl formamide, 0.33x PBS, 0.01% digitonin, 0.1% Tween-20, 100 nM Illumina Tn5 Transposase (Illumina, 20034197)) ...
-
Human CCR6+ Th cells show both an extended stable gradient of Th17 activity and imprinted plasticitybioRxiv - Immunology 2023Quote: ... The resulting cRNA samples were hybridized to an Illumina Human WG6 Expression BeadChip array for 14-20 hour at 58°C in an Illumina Hybridization Oven (Illumina Inc.). Arrays were washed and scanned following the protocols in the Illumina Whole-Genome Gene Expression Direct Hybridization Assay Guide (Illumina) ...
-
bioRxiv - Neuroscience 2024Quote: ... We sequenced pooled final libraries targeting 20 million reads per sample on the NovaSeq 6000 S4 flowcell (Illumina, San Diego, CA).
-
bioRxiv - Biochemistry 2024Quote: ... a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina adapters). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Biochemistry 2024Quote: As template a T7 promoter-containing oligonucleotide was annealed to an equimolar quantity of RBNS T7 template oligonucleotide (a random 20-mer flanked by partial Illumina primers). 500 fmol template were transcribed overnight at 37°C with 200 mM Tris-HCl pH 8.0 ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Libraries for each sample were prepared from ≥200 ng of sheared DNA with TruSeq® Nano DNA High Throughput Library Prep Kit (20015965, Illumina Inc., San Diego, CA, USA) and IDT for Illumina – TruSeq® DNA UD Indexes v1 (Illumina Inc. ...
-
bioRxiv - Genomics 2023Quote: ... we processed 500 ng of total RNA using the TruSeq Stranded mRNA Library Prep kit (Illumina, Cat # 20020595; Indexes: IDT for Illumina TruSeq RNA UD Indexes, cat # 20020591). The resulting libraries were then analyzed on a TapeStation (Agilent ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Reads were trimmed to remove adapter sequences and low-quality regions (Q < 30 and Q < 20 for Illumina and 454 data, respectively) were removed using Cutadapt 1.4.1 (Martin 2011 ...
-
bioRxiv - Cell Biology 2021Quote: ... 20 ul H2O) at 37◻°C for 30◻min (TruePrep® DNA Library Prep Kit V2 for Illumina, Vazyme, China). After the tagmentation ...
-
bioRxiv - Immunology 2020Quote: ... then sequenced to a depth of at least 20 M single-end 75 bp reads using NextSeq 500 (Illumina, San Diego, CA).
-
bioRxiv - Molecular Biology 2023Quote: Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides (Bolger et al., Trimmomatic: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl human genome version hg38 (Ensembl release 104 ...
-
bioRxiv - Cell Biology 2023Quote: RNA libraries were prepared using 200 ng of total RNA in 20 µl according to the manufacturer’s instructions for the Illumina Stranded mRNA Ligation Sample Prep Kit (Illumina, San Diego, CA). The concentration and size distribution of the completed libraries were determined using an Agilent Bioanalyzer DNA 1000 chip and Qubit fluorometry (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles, Tm 65 °C). We then performed a bead cleanup ...
-
bioRxiv - Molecular Biology 2020Quote: ... the NEBNext Ultra II DNA Library Preparation kit was used to generate libraries using 5-10 ng of input or immunoprecipitated DNA and barcode adaptors (NEBNext Multiplex Oligos for Illumina (Set 1, E7335 and Set 2, E7500)) ...
-
bioRxiv - Microbiology 2023Quote: ... half of the samples had libraries prepared using the Accel-NGS kit (Washtenaw County, Michigan) and the other half using the Nextera XT kit (Illumina, San Diego, CA; cat# FC-131-1024). The 40 virome libraries were sequenced with Illumina HiSeq-1TB ...
-
bioRxiv - Microbiology 2021Quote: ... Nextera XT indices were used to generate libraries from 1 ng of cDNA material for each sample following the instructions provided by Illumina (Illumina FC-131-1096 and FC-131-2001). Library preparations were purified using AMPure XP beads and checked for quality using the Agilent Bioanalyzer at Stanford Functional Genomics Facility (SFGF) ...