Labshake search
Citations for Illumina :
751 - 800 of 9629 citations for Urea Nitrogen BUN Detection Kit 2 Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Evolutionary Biology 2021Quote: ... sample 2 was treated with 20 U RNase R (Epicentre/Illumina, Cat. No. RNR07250) for 1 h at 37°C to degrade linear RNAs ...
-
bioRxiv - Biochemistry 2022Quote: ... or NextSeq with 2 × 151 paired-end reads and v2 or v2.5 chemistry (Illumina), and aligned to the hg38 genomic assembly ...
-
bioRxiv - Cancer Biology 2022Quote: ... Paired-end sequencing (2 x 100 bp) was carried out with HiSeq 4000 (Illumina), pooling two patients’ samples on one lane ...
-
bioRxiv - Genomics 2022Quote: ... scherzeri were sequenced with 2×150 bp chemistry on the Illumina MiSeq platform (Illumina), respectively ...
-
bioRxiv - Immunology 2022Quote: ... barcoding and sequencing using HiSeq configured for 2×150 bp paired-end reads (Illumina). An average of 28.9 × 106 paired reads was generated per sample with a mean quality score of 35.81 ...
-
bioRxiv - Plant Biology 2022Quote: ... Paired-end reads (2 × 150 bp) were generation on the HiSeq 3000 platform (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... whole SARS-CoV-2 genome cDNA libraries were generated using a MiniSeq system (Illumina) with a MiniSeq mid-output kit ...
-
bioRxiv - Immunology 2022Quote: Individually indexed libraries were sequenced using the MiSeq V3 2 × 300 cycle system (Illumina). The R1 and R2 reads were processed using the IgDiscover (TCR version) ...
-
bioRxiv - Physiology 2022Quote: ... Libraries were pooled and sequenced paired-ended for 2×75 cycles (Nextseq500 sequencer, Illumina). 30-40 million fragments were generated per sample and quality controls were performed ...
-
bioRxiv - Microbiology 2023Quote: ... The libraries were sequenced (2 × 150 base pairs (bp)) on a MiniSeq System (Illumina). Sequencing reads were aligned with the reference sequences and SHAPE-MaP reactivity profiles for each position was calculated using ‘Shapemapper-2.15’37 with default parameter ...
-
bioRxiv - Immunology 2023Quote: ... and paired end-sequenced on the NovaSeq 6000 (Illumina, read length 2 x 101bp). Adaptor sequences and polyT tails were trimmed from unprocessed reads with fqtrim (v 0.9.7 ...
-
bioRxiv - Pathology 2023Quote: ... Final pool was sequenced using the 2×151 bp P1 reagent (20050264, Illumina, USA) and NextSeq2000 sequencer ...
-
bioRxiv - Microbiology 2023Quote: ... (California, USA) for library prep and 2×150bp sequencing on a NovaSeq6000 (Illumina, USA). The run resulted in 21Gb of data with 140,278,770 raw reads ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced using HiSeq 2000 sequencing with 2 × 150 bp paired-end chemistry (Illumina). On average ...
-
bioRxiv - Microbiology 2023Quote: ... 2 × 1 μl (concentration of 10pmol/μl) MiSeq Nextera XT adapters (dual indexed, Illumina), and 6.5 μl of mQ water (Ultrapure) ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were sequenced 2 x 150 paired end using a NovaSeq 6000 instrument (Illumina) to get 30x coverage on the genome ...
-
bioRxiv - Microbiology 2023Quote: ... Transposon mutant 19_H4 was sent for whole genome sequencing (Illumina; 2 X 151 bp) to identify the insertion site of the transposon.
-
bioRxiv - Bioengineering 2023Quote: ... Libraries were then sequenced on NextSeq 500 Mid Output with 2×150 bp (Illumina). The Cell Ranger VDJ pipeline was used for sample de-multiplexing and barcode processing.
-
bioRxiv - Plant Biology 2023Quote: ... Paired-end reads (2 x 150 bp) were on a HiSeq 3000 instrument (Illumina). Sequencing reads were first quality trimmed and filtered with Trimmomatic (version 0.36 ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced with 2×150 bp paired-end reads on a NovaSeq platform (Illumina).
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGGAAC TGCTGTTTCCCACTT-3’ for bait 2 (Illumina prefix appended to downstream primer). The bait sequences for the IRX3 proximal promoter were ...
-
bioRxiv - Microbiology 2024Quote: ... using the Illumina MiSeq platform with a read length of 2 × 150 bp (Illumina). A subset of 100,000 reads was sampled for each phage ...
-
bioRxiv - Cancer Biology 2024Quote: ... 5’-AATGATACGGCGACCACCGAGATCTACACTCTTT CCCTACACGACGCTCTTCCGATCTTGCAGGA GCCCGAAGCA-3’ for bait 2 (Illumina prefix appended to downstream primer) and ...
-
The transcriptomic landscape of monosomy X (45,X) during early human fetal and placental developmentbioRxiv - Genetics 2024Quote: ... Libraries were subsequently sequenced on a NovaSeq S2 Flowcell (paired end 2×56bp) (Illumina). All samples in this study were prepared and sequenced at the same time ...
-
bioRxiv - Cancer Biology 2024Quote: ... Libraries were pooled and sequenced in (2 x 100bp) on the NovaSeq-6000 (Illumina). Gene and ERV expression was quantified as described (11,31 ...
-
bioRxiv - Neuroscience 2021Quote: Six hundred pg cDNA from each plate of cells was used in a modified Nextera XT (Illumina, San Diego, CA) library preparation ...
-
bioRxiv - Neuroscience 2021Quote: Tagmentation and library preparation using 600 pg of cDNA from each plate of cells was then performed with a modified Nextera XT (Illumina) protocol ...
-
bioRxiv - Genetics 2020Quote: ... equimolar amounts of amplification products from each sample of the 96-well microtiter plate were bulked and applied to c-Bot (Illumina) bridge PCR followed by sequencing on Illumina Hiseq2000 ...
-
bioRxiv - Physiology 2023Quote: ... The subsequent steps of library preparation were carried out on the Agilent NGS Bravo workstation in 96-well plates adapted for the TruSeq PCR-free Sample Preparation protocol by Illumina.
-
bioRxiv - Neuroscience 2023Quote: ... UV-cleaved oligonucleotides from each spatially resolved ROI were aspirated and collected in a 96-well collection plate to perform library prep with Seq Code primers and sequenced on an NextSeq500 sequencer instrument (Illumina). Digital count conversion files (DCC ...
-
bioRxiv - Immunology 2021Quote: ... DNA libraries were prepared using the Nextera XT DNA Library Preparation Kit and Nextera Index Kit (Illumina) following the manufacturer’s protocol with minor modifications ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina). Multiplexed libraries were pooled and paired-end 150-bp sequencing was performed on the Illumina HiSeq 4000 platform at Sidra Medicine ...
-
bioRxiv - Microbiology 2019Quote: ... rRNA depletion was performed (rRNA depletion Kit Ribo Zero Magnetic Kit for Gram-positive bacteria; Epicentre [Illumina]) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2019Quote: ... cDNA was amplified using Ovation V2 kit (NuGEN) and sequencing libraries were generated using NexteraXT kit (Illumina). RNA-seq was carried out on an Illumina HiSeq 4000 ...
-
bioRxiv - Microbiology 2020Quote: ... and libraries were constructed using a kit (NEB Ultra DNA library kit for Illumina; catalogue number E7370L), according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were made using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Gold Kit (Illumina). These libraries were sequenced using Illumina HiSeq platform with 100 bp single read at a depth of 10-20 million reads per sample.
-
bioRxiv - Microbiology 2022Quote: ... and libraries prepared using the NexteraXT kit and sequenced using HiSeq 1 × 150-cycle v3 kit (Illumina). The operational taxonomic unit (OTU ...
-
bioRxiv - Genomics 2022Quote: ... the TruSeq Stranded Total RNA Sample Preparation Kit and ScriptSeq v2 RNA-seq library preparation kit (Illumina) were used ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were generated using TruSeq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina ...
-
bioRxiv - Physiology 2023Quote: ... was purchased from Beckman Coulter. TruSeq PE Cluster Kit v3-cBot-HS kit (cat. PE-401-3001) was purchased from Illumina. Biospin Tissue Genomic DNA extraction Kit (cat ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75□bp paired-end sequencing method (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the NextSeq 500/550 High Output Kit v2.5 (300 Cycles) kit (cat. no. 20024908) (Illumina Inc.). The quality of the sequencing outputs was controlled using FastQC version 0.11.9 (Simon ...
-
bioRxiv - Microbiology 2023Quote: ... 500-cycle MiSeq Reagent Kit v2 or 600-cycle MiSeq Reagent Kit v3 (Illumina, California, United States), creating 2 × 150 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the HiSeq PE Rapid Cluster Kit v2 and HiSeq Rapid SBS Kit v2 (200 cycles, Illumina, USA) in the 100bp pair-end mode.
-
bioRxiv - Genomics 2021Quote: ... Cluster generation was performed using HiSeq SR Cluster Kit v3 cBot kits (Illumina Inc, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) or NovaSeq 6000 S4 Reagent Kit v1.0 (100 cycles) (Illumina) following manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc. ...