Labshake search
Citations for Illumina :
751 - 800 of 1305 citations for PCR Buffers since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended in the transposition reaction mix (2x TD Buffer (Illumina Cat #FC-121-1030, Nextera), 2.5⍰μl Tn5 Transposase (Illumina Cat #FC-121-1030 ...
-
bioRxiv - Neuroscience 2021Quote: ... Nuclei were then resuspended in 50 ul 1x TD Buffer containing 2.5 ul Tn5 enzyme from Nextera (Illumina) and incubated for 30 min at 37°C ...
-
bioRxiv - Microbiology 2020Quote: Five million fungal spheroblasts or 0.5 ng naked gDNA were resuspended in the tagmentation reaction mix (12.50 μL Nextera 2xTD buffer, 2.00 μL Nextera TDE1 [all Illumina] ...
-
bioRxiv - Immunology 2020Quote: ... the pellet was resuspended in 50 μL ATAC reaction mix (25uL 2X TD buffer, 2.5 μL Nextera Enzyme, 22.5 μL water, Illumina). The transposase reaction was carried out at 37°C for 30 minutes ...
-
bioRxiv - Molecular Biology 2021Quote: ... The resulting pellet was resuspended in transposase reaction mix (25μl cold lysisl 2x TD buffer, 10μl cold lysisl transposase (Illumina), 15μl cold lysisl nuclease-free H2O ...
-
bioRxiv - Cancer Biology 2022Quote: ... The transposition reaction mix (25μl of 2X TD buffer, 2.5μl of Tn5 transposase (Illumina, San Diego, CA, USA), 15ul of PBS and 7.5μl of nuclease free water ...
-
bioRxiv - Developmental Biology 2022Quote: ... The cell pellet was then re-suspended in 50ml of transposition reaction mix (25ml 2x TD buffer (Illumina), 2.5ml transposase (Illumina) ...
-
bioRxiv - Cancer Biology 2022Quote: ... 20,000 to 50,000 cells were lysed in the transposase reaction mix (12.5 μl 2xTD buffer, 2 μl TDE1 [Illumina] ...
-
bioRxiv - Genomics 2023Quote: ... DNA was tagmented by the addition of 10 µL of tagmentation mix (0.01 µL of a custom TDE1 enzyme in 9.99 µL of 2x Nexterda TD buffer, Illumina) and plates incubated at 55°C for 5 minutes ...
-
bioRxiv - Molecular Biology 2023Quote: ... The pellet was then resuspended in the transposition reaction mix (25 μL 2× TD buffer, 2.5μLTn5 Transposes (Illumina) and 22.5μL nuclease-free water ...
-
bioRxiv - Neuroscience 2023Quote: ... and pellets gently resuspended in 50 μL of transposition reaction mix (25 μL tagment DNA buffer (Nextera, Illumina), 2.5 μL tagment DNA enzyme (Nextera ...
-
bioRxiv - Cell Biology 2023Quote: ... The supernatants were carefully removed and the pellets were re-suspended in 25 μL of transposase reaction mix (12.5 μL 2×TD buffer, 1.25 μL TN5 transposase (Illumina) and 11.25 μL nuclease-free water) ...
-
bioRxiv - Genomics 2022Quote: ... To the 1.5 μl concentrated air DNA extraction we added 2.5 μl Illumina Nextera reaction buffer (FC-121-1030, Illumina), 1 μl 1 pg/μl Lambda DNA (SD0011 ...
-
bioRxiv - Evolutionary Biology 2023Quote: Sequencing libraries were prepared using the Tagment DNA Enzyme and Buffer Large Kit (Illumina, San Diego CA, USA), the KAPA HiFi HotStart ReadyMix 2X (Roche ...
-
bioRxiv - Synthetic Biology 2023Quote: Tagmentation Mix was prepared by mixing 1.25 μL Tagment DNA Buffer and 0.25 μL Tagment DNA Enzyme (Illumina), then added to 1 μL of plasmid DNA at a concentration of 1 ng/μL for a total reaction volume of 2.5 μL ...
-
bioRxiv - Genomics 2023Quote: ... the nuclei flash-frozen in the tube strips were thawed on ice and 13.7 μl of transposition buffer (which contains 12.5 μl of 2X Illumina Tagment DNA Buffer ...
-
bioRxiv - Cancer Biology 2024Quote: ... Nuclei were then resuspended in 50 μL transposition reaction mix containing 25 μL 2X Tagment DNA buffer (Illumina), 2.5 μL Tn5 transposase (Illumina) ...
-
bioRxiv - Cell Biology 2023Quote: ... The nuclear pellet was resuspended in transposition reaction mix using the Tagment DNA Enzyme and Buffer Kit (Illumina) as per manufacturer protocol ...
-
bioRxiv - Neuroscience 2023Quote: ... Nuclei were resuspended in 25uL of transposition mix (12.5ul 2x TD buffer, 1.25ul transposase (Illumina, catalog nr 20034197), 8.25ul PBS ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) and Qubit 3.0 with dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Genetics 2021Quote: Purified samples were then amplified by PCR (maximum 12 cycles) using barcoded primers from the Nextera Index Kit (Illumina). To determine the optimal number of cycles for each sample ...
-
bioRxiv - Genomics 2020Quote: Short-read sequence libraries for JI4 and JI128 were prepared using the TruSeq DNA PCR-Free Library Kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2020Quote: ... sgRNA libraries were generated using two-step PCR and sequenced by paired-end sequencing using a NextSeq 500 (Illumina).
-
bioRxiv - Immunology 2021Quote: ... and amplicons were used to perform the index PCR using the Nextera XT index v2 (Illumina #FC-131-1002). The index PCR products were cleaned with the Agencourt AMPure XP kit (Beckman Coulter #A63881 ...
-
bioRxiv - Genomics 2019Quote: ... Library preparation was performed following the Illumina Truseq DNA PCR-Free LT Library Prep Kit (Illumina, San Diego, CA) protocol using 1ug of isolated genomic DNA ...
-
bioRxiv - Genomics 2019Quote: ... The PCR products were then tagged using Nextera XT DNA Library Preparation Kit (Cat. 15032354, Illumina, San Diego, CA) and indexed using Nextera XT Index Kit (Cat ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were prepared for sequencing on the HiSeq2500 platform with the TruSeq DNA PCR-free Library Prep Kit (Illumina). In total 83 P ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were generated from1 µg of genomic DNA using the TruSeq® DNA PCR-free Library Prep Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... Genomic DNA from these cells was used for PCR amplification of sgRNAs and sequenced using a MiSeq system (Illumina). Fold depletion or enrichment of sgRNAs from the NGS data was calculated using PinAplPy software38.
-
bioRxiv - Immunology 2021Quote: ... PCR products were verified on 1.2% agarose gels and then indexed in a 2nd round PCR reaction using the Nextera Index kit (Illumina). PCR2 conditions for indexing were ...
-
bioRxiv - Microbiology 2019Quote: ... The resulting PCR products were purified and loaded onto the Illumina MiSeq cartridge (Illumina Inc., San Diego, Ca, USA).
-
bioRxiv - Immunology 2022Quote: ... PCR products were purified and paired-end sequenced using the MiSeq v3 reagent kit (Illumina, San Diego, CA, USA). Reads with quality score of ≥ 30 and mean quality score ≥ 35 were further processed ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Microbiology 2022Quote: ... Sequencing libraries were generated using the TruSeq DNA PCR-Free library prep kit (Illumina Inc., San Diego, CA, USA) and sequenced on an Illumina MiSeq instrument at 2 x 151 paired-end reads ...
-
bioRxiv - Microbiology 2022Quote: ... Next generation libraries were generated using the TruSeq DNA PCR Free Nano kit (Illumina, Inc., San Diego, CA, USA) and the ARTIC multiplex PCR genome amplification protocol with the V3 primer scheme (www.protocols.io/view/ncov-2019-sequencing-protocol-bbmuik6w ...
-
bioRxiv - Microbiology 2022Quote: ... The second round of PCR followed the manufacturer’s guidelines for 16S rRNA Metagenomic Sequencing Library protocol (Illumina, Cat.: 150442223) for the MiSeq system ...
-
bioRxiv - Genomics 2022Quote: ... Libraries of 550 bp inserts were constructed using Truseq DNA PCR-Free kit and sequenced on NextSeq500 (Illumina, USA). Raw reads were filtered as described above ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Neuroscience 2021Quote: ... The PCR reactions were sent to the @Bridge platform (INRAe, Jouy-en-Josas, france) for sequencing (Illumina Miseq technology). Single multiplexing was performed using home-made 6 bp index ...
-
bioRxiv - Cancer Biology 2022Quote: ... The first PCR aims to amplify genotyping fragments prior to sample indexing and uses P5 (binds the P5 Illumina sequencing handle ...
-
bioRxiv - Microbiology 2022Quote: ... The H37Rv samples were library prepped using an Illumina DNA PCR-free library prep kit (Illumina, San Diego, USA) (Supplementary table 1) ...
-
bioRxiv - Plant Biology 2019Quote: ... RT-qPCR was performed as described previously (Nakamichi et al., 2010) using an Eco Real-Time PCR System (Illumina). Gene expression was normalized against IPP2 ...
-
bioRxiv - Developmental Biology 2020Quote: ... Clean PCR amplicons from the same DNA sample were pooled to generate 137 libraries that were sequenced by Illumina MiSeq v3 ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by limited PCR enrichment to generate the final cDNA sequencing library (Nextera® XT DNA Library Prep, Illumina). Libraries were sequenced as single-end 75 base pair reads on the Illumina NextSeq500 per the manufacturer’s instructions.
-
bioRxiv - Genetics 2019Quote: ... All sequencing followed the protocol in the Illumina TruSeq PCR-Free Sample Preparation Guide (Illumina cat# FC-121-2001), and used PCR-free library preparation kits purchased from KAPA Biosystems (see https://www.nhlbiwgs.org/topmed-whole-genome-sequencing-project-freeze-5b-phases-1-and-2 for additional details) ...
-
bioRxiv - Genetics 2020Quote: ... Serial PCRs were performed for targeted deep sequencing and then a MiniSeq sequencing platform (Illumina, San Diego, CA, USA) was used for next generation sequencing (NGS) ...
-
bioRxiv - Genomics 2021Quote: ... to prepare PCR-free paired-end libraries using the Illumina Genomic DNA Sample Preparation kit following the manufacturer’s instructions (Illumina). All paired-end libraries were sequenced on an Illumina NovaSeq 6000 system ...
-
bioRxiv - Genomics 2020Quote: ... 600 pg of PCR product was prepared into Illumina sequencing libraries through tagmentation with a Nextera XT kit (Illumina). Tagmentation was performed according to manufacturer’s instructions and the library was amplified with primers Truseq5 and N700 series barcoded index primers ...
-
bioRxiv - Genomics 2021Quote: ... The purified PCR products were then subjected to a multiplexing process using Nextera XT Index kit (Illumina, California, USA) in 50 μL reactions ...
-
bioRxiv - Genomics 2019Quote: ... 415 out of 427 libraries were prepared the TruSeq DNA PCR-free Library Prep Kit (Illumina, San Diego, CA). For the remaining 12 libraries ...