Labshake search
Citations for Illumina :
751 - 800 of 9311 citations for Human Fibrinogen C Domain Containing Protein 1 FIBCD1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... RNA-seq libraries were generated using TruSeq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75bp paired-end sequencing method (Illumina ...
-
bioRxiv - Immunology 2023Quote: ... for 2 × 250 cycles using MiSeq PE cluster generation kits and MiSeq SBS Kit sequencing reagents (Illumina).
-
bioRxiv - Physiology 2023Quote: ... was purchased from Beckman Coulter. TruSeq PE Cluster Kit v3-cBot-HS kit (cat. PE-401-3001) was purchased from Illumina. Biospin Tissue Genomic DNA extraction Kit (cat ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were prepared using the Nextera XT DNA Sample Preparation Kit and the Nextera Index Kit (Illumina) as per manufacturer instructions ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA-seq libraries were generated using Truseq RNA Access Library Prep Kits (TruSeq RNA Exome kits; Illumina) and sequenced on NextSeq500 sequencers using 75□bp paired-end sequencing method (Illumina ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... using the NextSeq 500/550 High Output Kit v2.5 (300 Cycles) kit (cat. no. 20024908) (Illumina Inc.). The quality of the sequencing outputs was controlled using FastQC version 0.11.9 (Simon ...
-
bioRxiv - Microbiology 2023Quote: ... 500-cycle MiSeq Reagent Kit v2 or 600-cycle MiSeq Reagent Kit v3 (Illumina, California, United States), creating 2 × 150 ...
-
bioRxiv - Genomics 2019Quote: DNA was extracted and genotyped from a total of 867 samples (START mothers) using the Illumina Human CoreExome-24 and Infinium CoreExome-24 arrays (Illumina, San-Digeo, CA, USA). Data was cleaned using standard quality control (QC ...
-
bioRxiv - Cancer Biology 2023Quote: ... RNA sequencing libraries were generated according to the manufacturer’s instructions for the TruSeq totalRNA with RiboZero Human/Mouse/Rat Gold (Illumina, San Diego, CA, United States). Sequencing was then performed on the NovaSeq6000 (Illumina ...
-
bioRxiv - Genetics 2024Quote: ... Bisulfite-converted DNA samples were randomly assigned to a chip well on the Infinium Human Methylation EPIC v2 BeadChip (Illumina, Inc., San Diego, CA) or in the Human Imprintome array BeadChip (Illumina ...
-
bioRxiv - Cancer Biology 2024Quote: ... was shipped on dry ice to the UCLA Neurogenomics Core facility (Los Angeles, CA) for analysis using Illumina HT-12 v4 human microarrays (Illumina Inc., San Diego, CA). The order of the sections was randomized prior to shipment to avoid confounding potential technical artifacts with potential biological gradients of gene expression ...
-
bioRxiv - Cell Biology 2020Quote: ... Tagmentation was performed during 30 minutes at 25°C in a 50 μl reaction in TD Buffer (Illumina, FC-121-1030) containing 2.5 μl Tn5 Transposes (Illumina ...
-
bioRxiv - Genetics 2021Quote: ... Illumina’s non-redundant unique dual indexes (UDI) were used in this step (IDT for Illumina Nextera DNA Unique Dual Indexes Set C, Illumina Inc.). Indexed PCR amplicons were purified using HighPrep PCR Clean-up magnetic beads (MagBio Genomics ...
-
bioRxiv - Plant Biology 2021Quote: ... The chimeric fragments were isolated and then constructed to five Hi-C libraries that were sequenced on an Illumina NovaSeq platform (Illumina, USA) with 2×150 bp pair-end reads ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
Induction of Dopaminergic Neurons for Neuronal Subtype-Specific Modeling of Psychiatric Disease RiskbioRxiv - Neuroscience 2021Quote: ... RNA fragmentation was performed at 94°C for 6 minutes and 10 PCR cycles were used during library amplification with TruSeq single-index adapters (Illumina, #20020492). Final library concentrations were quantified with both Qubit fluorometric quantification (DNA dsDNA HS kit ...
-
bioRxiv - Genomics 2023Quote: ... or flash-frozen in liquid nitrogen and stored at −80°C until extraction (for both PacBio SMRT sequencing and Illumina HiSeq) from a clone of ‘Montmorency’ and an accession of P ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The Omni-C library was sequenced to approximately 30× coverage on an Illumina NovaSeq 6000 instrument (Illumina, Inc., San Diego, CA).
-
bioRxiv - Evolutionary Biology 2020Quote: ... using the HiSeq PE Rapid Cluster Kit v2 and HiSeq Rapid SBS Kit v2 (200 cycles, Illumina, USA) in the 100bp pair-end mode.
-
bioRxiv - Genomics 2021Quote: ... Cluster generation was performed using HiSeq SR Cluster Kit v3 cBot kits (Illumina Inc, San Diego, CA, USA).
-
bioRxiv - Microbiology 2021Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... and NovaSeq 6000 S4 Reagent Kit v1.5 (200 cycles) or NovaSeq 6000 S4 Reagent Kit v1.0 (100 cycles) (Illumina) following manufacturer instructions ...
-
bioRxiv - Microbiology 2020Quote: DNA libraries were constructed with the Nextera XT Library Preparation Kit and Index Kit (Illumina, San Diego, CA). DNA libraries were pooled and sequenced on both the Illumina HiSeq5000 and HiSeq2500 and fastq files were generated from demultiplexed reads with bcl2fastq Conversion Software (Illumina ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... or the NEBNext Ultra DNA Library Prep Kit for Illumina (formerly NEBNext DNA Library Prep Kit for Illumina; New England Biolabs Inc. ...
-
bioRxiv - Immunology 2021Quote: ... using 2 × 300 bp paired-end kits (Illumina MiSeq Reagent Kit v3, 600-cycle, Illumina Inc., CA, USA).
-
bioRxiv - Microbiology 2021Quote: ... a combined kit for the ribosomal (rRNA) depletion Ribo-Zero™ Kit (Bacteria) (Epicentre, Illumina, Madison, WI USA) and cDNA library construction kit ...
-
bioRxiv - Genomics 2023Quote: ... using the S2 Reagent Kit v1.5 Paired End 2×50 base (100 cycle) sequencing kit (Illumina cat. #20028316). Sequencing parameters were set for R1 at 28 cycles ...
-
bioRxiv - Genetics 2022Quote: ... rRNA was depleted with EPiCenter Ribo-Zero Magnetic Gold Kit (Yeast) RevA kit (Illumina Inc, San Diego, CA), and the remaining RNA was purified using Agencourt RNACleanXP (Beckman Coulter ...
-
bioRxiv - Genetics 2023Quote: ... using the HiSeq 3000/4000 SBS Kit or NovaSeq 6000 SP or S2 Reagent Kit (100 Cycles) (Illumina).
-
bioRxiv - Molecular Biology 2023Quote: ... using the HiSeq 3000/4000 SBS Kit or NovaSeq 6000 S2 or S4 Reagent Kit (200 Cycles) (Illumina). An average of 64 million paired reads were generated per sample ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Genetics 2020Quote: ... 0.02 µM of specific adapters for the Illumina technology (containing the barcode sequences and complementary to the Illumina ™ primers for sequencing) were connected to the fragments ends generated in the digestion ...
-
bioRxiv - Plant Biology 2023Quote: ... The nuclei pellet was then immediately resuspended in 25 μ L of 2x tagmentation buffer containing 2 μ L of TDE1 (Illumina). The reaction was placed at 37C for 30 minutes with gentle mixing three times ...
-
bioRxiv - Plant Biology 2020Quote: ... The ARTseq/TruSeq Ribo Profile Kit (Illumina) was used to construct sequencing libraries ...
-
bioRxiv - Developmental Biology 2021Quote: ... TruSeq Stranded mRNA Library Preparation Kit (Illumina) was used to make the libraries for sequencing according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2021Quote: ... TruSeq Stranded mRNA library prep kit (Illumina) was used to generate the mRNA libraries ...
-
bioRxiv - Developmental Biology 2021Quote: ... Nextera XT DNA library preparation kit (Illumina) was used to prepare library.120pg of cDNA was simultaneously fragmented and tagged with adapter sequences by transposome ...
-
bioRxiv - Cell Biology 2020Quote: ... for NGS using the V2 kit (Illumina). All raw and processed sequencing data have been submitted to the NCBI Genome Expression Omnibus (GEO ...
-
bioRxiv - Developmental Biology 2021Quote: ... or a TruSeq Stranded mRNA kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... Truseq RNA sample preparation kit v2 (Illumina) was used for the preparation of sequencing libraries ...
-
bioRxiv - Immunology 2021Quote: ... or S4 Reagent Kit (300 cycles) (Illumina). An average of 129 million paired reads was generated per sample.
-
bioRxiv - Genetics 2021Quote: ... using TruSeq SBS Kit v3-HS (Illumina). RNAseq data are available on GEO using accession number GSE145852.
-
bioRxiv - Evolutionary Biology 2020Quote: ... with TruSeq PE Cluster Kit v3 (Illumina) and after that sequenced using Illumina HiSeq 2000 sequencing machine ...
-
bioRxiv - Developmental Biology 2021Quote: ... and amplified using the SmartSeq2 kit (Illumina) for the study within the somatic lineage and SMART-Seq v4 Ultra (Takara Bio ...
-
bioRxiv - Genomics 2020Quote: ... or TruSeq NanoDNALT Library Prep Kit (Illumina) were used to generate dual-indexed sequence following the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2021Quote: ... using a NovaSeq S4 Reagent Kit (Illumina). Sequencing was performed using the following read protocol ...
-
bioRxiv - Cell Biology 2022Quote: ... a Hiseq 4000 SR Cluster Kit (Illumina) was used using 8 pM of pooled normalized libraries on the cBOT V2 ...
-
bioRxiv - Genomics 2020Quote: ... and HiSeq Rapid SBS Kit v2 (Illumina), HiSeq X (Illumina ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... using the Paired-End Clustering kit (Illumina). Each pool DNA library was further paired-end sequenced on a HiSeq 2500 (Illumina ...
-
bioRxiv - Genomics 2019Quote: ... Using the TruSeq nano DNA kit (Illumina), the 3’ ends of blunt fragments were adenylated ...