Labshake search
Citations for Illumina :
751 - 800 of 2113 citations for 6 Chloro 3 methylimidazo 1 2 b pyridazine since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Immunology 2019Quote: ... CC (third part, forward primer linker) AGMGTTYGATYMTGGCTCAG (fourth part, forward primer) and 338R CAAGCAGAAGACGGCATACGAGAT (first part, reverse complement of 3′ Illumina adaptor) ACGAGACTGATT (second part ...
-
bioRxiv - Neuroscience 2020Quote: ... Samples were processed according to the standard 10x Chromium 3’ workflow and pooled before sequencing over two lanes (Illumina HiSeq 4000).
-
bioRxiv - Cancer Biology 2019Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina indexed adapters from TruSeq™ Stranded Total RNA Sample Preparation Kit with Ribo-Zero Gold (Illumina) were ligated.
-
bioRxiv - Cancer Biology 2020Quote: ... 500 ng alkylated RNA was used and prepared with a commercially available kit (QuantSeq 3′ mRNA-Seq Library Prep Kit FWD for Illumina and PCR Add-on Kit for Illumina, Lexogen). Sequencing was performed on an Illumina NovaSeq SP platform in 100bp-single-read mode.
-
bioRxiv - Genomics 2021Quote: ... and ligated to custom CpG-free annealed adapters (Oligo 3 - Custom CpG-free P7 adapter and Oligo 4 - Custom CpG-free P5 adapter; annealed according to the standard Illumina protocol). The adapter-ligated gDNA was purified and amplified in 20 reactions using KAPA HiFi master mix (Roche ...
-
bioRxiv - Genomics 2021Quote: ... and 1µM Dexamethasone or 0.1% ethanol for 3 hours. Transposition was performed using the OmniATAC protocol (Corces et al. 2017) and the tagment DNA TDE1 enzyme (Illumina, 20034197). DNA was purified using the MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Cell Biology 2022Quote: The input samples were submitted to the Washington University Genome Technology Access Center to obtain and sequence the cDNA libraries (10XGenomics, 3’v3.1; Illumina NovaSeq S4) according to established protocols ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 x 105 mESCs and 5 x 104 S2 cells were resuspended in Tagment DNA Buffer and treated with 3 µL TDE1 Tagment DNA Enzyme (Illumina 20034197). After thorough mixing ...
-
bioRxiv - Genomics 2023Quote: For all tandem repeat identification and quantification we used DNA sequences from 2,504 individuals from the Phase 3 of the 1,000 Genomes Project (∼30x coverage Illumina short-read data) (Byrska-Bishop et al ...
-
bioRxiv - Genomics 2023Quote: ... 200ng alkylated RNA were used as input for generating 3’-end mRNA sequencing libraries using a commercially available kit (QuantSeq 3ʹ mRNA-Seq Library Prep Kit FWD for Illumina, Lexogen).
-
bioRxiv - Immunology 2024Quote: ... 2024) using the command CreateSeuratObject with the following parameters: min.cells = 3 and either min.features = 200 (for Illumina reads from MBC gate) or min.features = 100 (for the Oxford Nanopore reads from the ASC gate) ...
-
bioRxiv - Cancer Biology 2024Quote: ... Then the scRNA-seq libraries were constructed by using the Chromium Next GEM Single Cell 3’ Reagent Kits v3 (10X Genomics, USA) and sequenced by using the sequencer Novaseq6000 (Illumina, USA). All procedures were following the manufacturer’s protocol.
-
bioRxiv - Cancer Biology 2021Quote: ... RNA samples were further processes according to the TruSeq Sample Preparation v.2 Guide (Illumina) and paired end-sequenced on the HiSeq 2500 (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Small RNA libraries were diluted to 2 nM and run on a miSeq System (Illumina) for NGS using the V2 kit (Illumina) ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were then sequenced with 2×150bp paired-end reads on an Hiseq3000 instrument (Illumina).
-
bioRxiv - Genetics 2021Quote: ... Libraries were prepared with a TruSeq RNA Library Prep Kit version 2 (Illumina RS-122) and sequenced on an Illumina HiSeq4000 in paired-end mode (PE150).
-
bioRxiv - Evolutionary Biology 2021Quote: ... with 300 cycle mid-output (2×150 bp) NextSeq Reagent kits v2 (Illumina Corporation, 20024905). FASTQ files of raw sequencing data were deposited in NCBI database with the Sequence Read Archive (SRA ...
-
bioRxiv - Developmental Biology 2021Quote: ... followed by paired-end sequencing (2 x 75 bp) performed with Nextseq 500 (Illumina, USA). Libraries were sequenced in triplicate ...
-
bioRxiv - Genomics 2020Quote: ... The samples were then sequenced (2×101 cycles, paried end reads) on the HiSeq2500 (Illumina) using the TruSeq SBS Kit v3-HS 200 cycles Kit (Illumina) ...
-
bioRxiv - Cell Biology 2022Quote: ... 2×150bp paired-end sequencing (PE150) was performed on an Illumina Novaseq™ 6000 (Illumina) following the vendor’s recommended protocol.
-
bioRxiv - Genomics 2020Quote: ... Paired end libraries (2×150 bp) were sequenced on an Illumina HiSeq4000 instrument (Illumina Inc.).
-
bioRxiv - Genomics 2020Quote: ... Paired-reads (2×100 bp) were sequenced on the NovaSeq 6000 S2 flowcell (Illumina, Inc.). DNA and RNA library preparation and sequencing were performed at the SNP&SEQ Technology Platform in Uppsala ...
-
bioRxiv - Cell Biology 2019Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample.
-
bioRxiv - Physiology 2020Quote: ... Libraries were run over 4 lanes (2 × 100 bp) on a HiSeq 2500 (Illumina Inc.) resulting in an average of 34.4 million reads per sample ...
-
bioRxiv - Microbiology 2020Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Microbiology 2020Quote: ... and sequenced with 2×250 bp cycles of v2 Miseq chemistry (Illumina, San Diego, CA). Replicate reactions from each sample were pooled and gel purified using the Blue Pippin Prep system (Sage Science ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... and small-scale sequencing (2 x146bp) on an iSeq platform (Illumina, San Diego, CA, US). Subsequent equimolar pooling of individual libraries from each plate was performed prior to performing large-scale paired-end sequencing (2 × 146 bp ...
-
bioRxiv - Microbiology 2021Quote: ... and sequenced as 2 × 150 base pair reads on the Illumina NextSeq 550 instrument (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... and paired-ended [2×150 bp] sequencing was performed on NovaSeq 6000 sequencing system (Illumina). Once the sequencing run was completed ...
-
bioRxiv - Microbiology 2021Quote: ... 100x coverage using a high-output paired end 2 x 150 sequencing regent kit (Illumina).
-
bioRxiv - Synthetic Biology 2022Quote: ... read length 2 × 175 bp using the MiSeq platform (Illumina Inc., San Diego, CA, USA). The library preparation and sequencing were performed in the Institute of Genomics Core Facility ...
-
bioRxiv - Cancer Biology 2020Quote: ... 2 x 150 cycles (NextSeq 500/550 Mid Output v2 kit, Illumina, San Diego, CA).
-
bioRxiv - Developmental Biology 2022Quote: ... 2 sequencing libraries were constructed using TruSeq® Stranded Total RNA Library Prep (20020597, Illumina) kit at the National Cancer Institute’s Center for Cancer Research sequencing core facility ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... and sequenced with 2 × 250 base paired-end reads on the Illumina MiSeq platform (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2022Quote: ... Each library was then paired end sequenced (2×75bp) on a NextSeq 500 instrument (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... Sample libraries of sufficient quality were sequenced (Illumina MiSeq; paired end 2 × 75bp read length) with a sequencing depth targeted at 7-10M total paired end reads/sample at the Center for Genome Innovation at the University of Connecticut.
-
bioRxiv - Genomics 2020Quote: ... and then subjected to Next Generation Sequencing in NextSeq 550 equipment (2×150bp) (Illumina, USA). The reads were deposited in the European Nucleotide Archive (ENA ...
-
bioRxiv - Systems Biology 2020Quote: ... Paired-end sequencing (2×125-bp) was carried out on a HiSeq 2500 instrument (Illumina) at the Kinghorn Center for Clinical Genomics ...
-
bioRxiv - Molecular Biology 2019Quote: ... Libraries were pooled and pair-end sequenced (2×75 bp) on the MiSeq platform (Illumina). Two biological replicates of each immuprecipitation were analysed ...
-
bioRxiv - Molecular Biology 2019Quote: DNA libraries were sequenced on a MiSeq using 2×75 paired-end chemistry (v3, Illumina) Sequenced MiSeq chips were stored at 4°C in storage buffer (10 mM Tris-Cl ...
-
bioRxiv - Microbiology 2020Quote: ... DNA sequencing was performed using a MiSeq v2 500 cycle kit (2×250bp reads; Illumina). Raw reads were trimmed using fastq-mcf and assembled using SPADES v3.9.1 [25] ...
-
bioRxiv - Microbiology 2021Quote: ... High-throughput sequencing was performed with a MiSeq Illumina sequencer (2 × 300 bp, Illumina Inc.) by the Biomics Pole (Institut Pasteur) ...
-
bioRxiv - Immunology 2021Quote: The 150×2 paired-end sequencing was conducted on a Novaseq sequencer (Illumina, CA, USA) producing 612,180,910 raw paired reads on average.
-
bioRxiv - Genomics 2021Quote: ... Libraries were sequenced as paired end 2×151 read multiplex runs on MiSeq platform (Illumina). Sequenced reads have been uploaded to the NCBI SRA database under BioProject ID PRJNA762079.
-
bioRxiv - Genomics 2021Quote: ... the 18 individual libraries were pooled using equimolar amounts and sequenced by Illumina NovaSeq 2×150 cycles run for a total of 0.5 lane (Illumina Inc., CA, U.S.)
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were constructed from 2 μL of DNA using the Nextera XT Kit (Illumina) and cleaned with 0.6x volumes of Ampure XP beads (Beckman Coulter) ...
-
bioRxiv - Genomics 2022Quote: ... We downsampled the existing Illumina (2×150 bp, generated with Illumina HiSeq 2500 Rapid SBS) alignment file of 300× to ~100× ...
-
bioRxiv - Cancer Biology 2022Quote: Paired-end sequencing (2 x 150 bp) was performed with HiSeq X-Ten instruments (Illumina). Two lanes ...
-
bioRxiv - Microbiology 2022Quote: ... Whole genome was paired-end sequenced (2 × 150 bp) in an Illumina NovaSeq6000 platform (Illumina) at Centro Nacional de Análisis Genómico (CNAG-CRG ...
-
bioRxiv - Plant Biology 2023Quote: ... before being prepared for loading using a NovaSeq XP 2 lane kit v1.5 (20043130, Illumina). This was sequenced with 150 paired-end reads on an Illumina NovaSeq 6000 with NVCS 1.7.5 and RTA v3.4.4 on one lane of a NovaSeq S4 v1.5 flow cell with accompanying reagent cartridges (20028312 ...