Labshake search
Citations for Illumina :
751 - 800 of 1661 citations for 2 4 Methyl 5 thiazolyl ethyl decanoate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2021Quote: ... since values ΔCq > 5 are not suitable for further downstream processing for Infinium HD FFPE Restore Protocol (Illumina, Inc.) and Infinium MethylationEPIC array (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... and 5K samples were resuspended in 50 μl, 10 μl, and 5 μl of transposition mix (25 μl 2x TD buffer, 2.5 μl Tn5 (Illumina), 16.5 μl PBS (Invitrogen) ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Physiology 2024Quote: ... tagmented DNA was amplified by PCR in a reaction mix (5 µL DNA, 2.5 µL of 25 μM forward primer (Nextera/Illumina i5 adaptors (Illumina)) ...
-
bioRxiv - Cancer Biology 2022Quote: Gene expression data was generated with the Chromium Single Cell 5’ v3.1 assay (10X Genomics) and sequenced on the NovaSeq 6000 platform (S1 flow cell, Illumina). To generate gene-barcode count matrices ...
-
bioRxiv - Cell Biology 2024Quote: ... libraries were equimolarly pooled and 1.8 pM of the pool with 5% PhiX were loaded on a NextSeq 500 (Illumina) for a 75 bp paired-end sequencing run at the Research Sequencing Facility of ERIBA (UMCG).
-
bioRxiv - Microbiology 2024Quote: ... to which 5 µl of P7 and P7 of Nextera XT Index Kit v2 index primers (Illumina, Cambridge, UK) and 7 µl of the previous tagmentation reaction were added ...
-
bioRxiv - Neuroscience 2024Quote: ... 5 ul of Tn5 tagmentation mix (1X Tagment DNA buffer, Illumina; ATM mix, Illumina and cDNA library 1 ng) was prepared for cDNA fragmentation ...
-
bioRxiv - Genomics 2024Quote: ... libraries were amplified for 5 cycles with 0.5 μl i5 and i7 Nextera adapters (10 μM) following the instructions provided by Illumina. Finally ...
-
bioRxiv - Genetics 2024Quote: ... 5 µg of total RNA for each sample was then processed using the Tru-Seq stranded mRNA kit (Illumina) following manufacturer instructions ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries for 5 biological replicates were pooled and 100bp paired end reads were generated on a NovaSeq 6000 (Illumina). Reads were trimmed and quality filtered using TrimGalore with a minimum phred score of 20 then aligned to hg19 using STAR 64 with quantMode to obtain read counts ...
-
bioRxiv - Plant Biology 2020Quote: 126 cDNA libraries were prepared using the Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, USA) from isolated RNA ...
-
bioRxiv - Plant Biology 2020Quote: ... where they were sequenced on a MiSeq instrument in paired-end 2 × 300 bp mode (Illumina, USA). The raw sequencing data was deposited at the European Nucleotide Archive (http://www.ebi.ac.uk/ena) ...
-
bioRxiv - Developmental Biology 2021Quote: ... and were sequenced on the Illumina NovaSeq (>70 million 2×150 bp sequences) (Illumina, San Diego, CA).
-
bioRxiv - Developmental Biology 2021Quote: ... Paired-end 2 x 75 bp NSQ 500/550 Hi Output KT v2.5 −75 CYS (Illumina, 20024906) was performed for RNA-seq libraries on an Illumina Nextseq 500 instrument ...
-
bioRxiv - Cell Biology 2020Quote: ... and samples were subsequently sequenced (paired end, 2×250bp) on a HiSeq1500 machine (Illumina, San Diego, CA). Bio-informatic analysis of the data was done with an in-house developed pipeline based on Picard Tools (Broad Institute ...
-
bioRxiv - Genetics 2021Quote: ... Libraries were each sequenced on one full 2 × 150 bp PE (paired end) HiSeq 4000 lane (Illumina).
-
bioRxiv - Genomics 2021Quote: ... The pooled libraries were sequenced in an Illumina HiSeq4000 instrument (2 x 150 bp PE reads) (Illumina). A PhiX control library was applied to the sequencing run as a base balanced sequence for the calibration of the instrument so that each base type is captured during the entire run ...
-
bioRxiv - Molecular Biology 2021Quote: Libraries were sequenced using paired end sequencing (2 × 150 bp) on a NovaSeq high-throughput sequencer (Illumina) at the University of Colorado Genomics Core Resource ...
-
bioRxiv - Molecular Biology 2020Quote: ... beginning at Elution 2 – Fragment – Prime step immediately preceding cDNA synthesis according to the manufacturer instructions (Illumina) with the following modifications ...
-
bioRxiv - Genomics 2020Quote: ... Amplicons were paired-end (2 × 250 nt) sequenced on an Illumina NovaSeq (Illumina, San Diego, CA, USA).
-
bioRxiv - Genomics 2020Quote: ... using the Illumina MiSeq platform (2×1300 paired-end; MiSeq Reagent Kit v3 supporting 600-cycles, Illumina). The resulting sequence reads were filtered ...
-
bioRxiv - Cell Biology 2020Quote: ... The libraries were sequenced in multiplex (n=2 per sequencing run) on the NextSeq 500 sequencer (Illumina) to produce between 200 and 250 million reads per library.
-
Limited haplotype diversity underlies polygenic trait architecture across 70 years of wheat breedingbioRxiv - Genomics 2020Quote: ... Sequencing with 2×150bp reads was performed at the Earlham Institute on a NovaSeq 6000 instrument (Illumina) with 16 promoter capture libraries on one lane and 16 genic capture libraries on another lane.
-
bioRxiv - Biochemistry 2021Quote: ... and 2 × 76 paired-end sequencing performed using the Illumina NextSeq 500 (Illumina, San Diego, CA, USA).
-
bioRxiv - Cancer Biology 2021Quote: ... They were sequenced to a targeted depth of 40M 2×100bp reads on a NovaSeq 6000 (Illumina). Differential expression analysis was performed by reading kallisto counts files into R using the R packages tximport (v.1.10.1 ...
-
bioRxiv - Cancer Biology 2020Quote: ... pH 7.6] and Transposition buffer [2 µl of Illumina adapters-bearing Tn5 transposase (FC-121-1030, Illumina), 0.02% digitonin and 0.2% Tween-20 in PBS] ...
-
bioRxiv - Plant Biology 2021Quote: ... Using 2 x 150 bp paired-end reads generated with the Nextera Truseq libraries (Illumina, CA, USA).
-
bioRxiv - Plant Biology 2021Quote: ... RNAseq libraries were prepared using the Illumina TruSeq RNA sample preparation kit v.2 (Illumina, CA, USA) and barcoded individually following the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2021Quote: ... and paired-end (2×150 bp) sequencing was performed on a NovaSeq 6000 sequencer (Illumina Inc., USA) from the Macrogen Inc ...
-
bioRxiv - Microbiology 2020Quote: ... The prepared library was sequenced on the NovaSeq 6000 platform (2 × 150 bp chemistry) (Illumina, United States).
-
bioRxiv - Microbiology 2020Quote: ... one PCR reaction of 12 cycles was performed (using 2 µL of 3C library, 0.2 µM Illumina primers PE1.0 and PE2.0 and 1 unit of Taq Phusion [Finnzymes]) ...
-
bioRxiv - Molecular Biology 2022Quote: ... multiplexed, and sequenced (Paired-end, 2×150 bp sequencing) on a HiSeq 4000 sequencer (Illumina, Cambridge, UK). 3 biological replicates were analysed per condition.
-
bioRxiv - Immunology 2022Quote: ... and the cell pellet was carefully resuspended in the transposition reaction (25 µl 2 × TD buffer (Illumina), 2.5 µl TDE1 (Illumina) ...
-
bioRxiv - Molecular Biology 2022Quote: Libraries were sequenced using paired end sequencing (2 × 150 bp) on a NovaSeq high-throughput sequencer (Illumina) at the University of Colorado Genomics Core Resource ...
-
bioRxiv - Genomics 2022Quote: ... (2) The linked read sequencing libraries were constructed on 10X Genomics GemCode platform and sequencing from Illumina platforms ...
-
bioRxiv - Microbiology 2020Quote: ... Paired-end sequencing (250 x 2) was performed on the Illumina MiSeq (Illumina Inc., San Diego, CA). PCR amplification and sequencing were performed by the Cincinnati Children’s Hospital and Medical Center DNA Core.