Labshake search
Citations for Illumina :
701 - 750 of 1004 citations for Recombinant Human EFNA5 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2024Quote: ... or in the Human Imprintome array BeadChip (Illumina, Inc., San Diego, CA), amplified ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was analyzed using Infinium Human Methylation 450K BeadChip system (Illumina), as described [91] ...
-
bioRxiv - Developmental Biology 2021Quote: ... ATAC-seq libraries for murine endothelial cells were processed as previously described (Buenrostro et al., 2015) and libraries were generated using the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030). The quality of purified DNA libraries was checked by Agilent High Sensitivity DNA kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Jude Children’s Research Hospital Hartwell Center with DNA libraries prepared using Nextera XT DNA-Seq library prep kits (Illumina, cat#FC-131-1024) with 96 dual-index bar codes and sequenced on an Illumina MiSeq personal genome sequencer ...
-
bioRxiv - Developmental Biology 2020Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 pM and sequencing configuration as following ...
-
bioRxiv - Developmental Biology 2021Quote: Approximately 50,000 nephron progenitor cells were used to generate each sequencing library for the assay for transposase-accessible chromatin (ATAC-seq) using the Nextera DNA Flex Library Prep Kit (Illumina FC-121-1030) with modifications according to a previously published method (Buenrostro et al. ...
-
bioRxiv - Genomics 2022Quote: ... One ng of the pooled amplicons was used for library construction with the Nextera XT DNA library preparation kit (#FC-131–1096; Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were resuspended in 25 μl of 2X TD Buffer and combined with Tn5 enzyme from the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030) and water to final volume 50 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were resuspended in 50 μl of the following PCR master mix with indexed primers from the Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011): Phusion HF 2X (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting library was diluted to 10-pM in 600-μL of HT1 hybridization buffer (Illumina Nextera XT kit Cat#FC-131-1024) and 10-μL was loaded onto a 300-cycle MiSeq Nano v2 flow cell (Illumina Cat#MS-102-2002 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA from approximately 15-20 progeny per mutant were pooled and sequencing libraries were prepared with a Nextera kit (Illumina, FC-121-1030). All whole genome sequencing data is available on NCBI SRA (accession #PRJNA526508) ...
-
bioRxiv - Genomics 2020Quote: ... The dissolved DNA was then tagmented using 0.6 μl TD Tagmentation buffer and 0.3 μl ATM Tagmentation enzyme from Nextera DNA Library Prep Kit (Illumina, catalog no. FC-121-1030) for 5min at 55 °C ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Genomics 2019Quote: ... Four libraries were paired-end sequenced (75 nt each) with the NextSeq 500 using the Mid Output v2 kit (150 cycles) (Illumina, #FC-404-2001).
-
bioRxiv - Genomics 2019Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using custom ReadOne primer (IDT) and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 nM ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... homokaryotic mutants were crossed to a genetically polymorphic Mauriceville strain and approximately 15-20 antibiotic-resistant progeny were pooled and prepared for whole genome sequencing using the Nextera kit (Illumina, FC-121-1030). Mapping of the critical mutations was performed as previously described (Hunter 2007 ...
-
bioRxiv - Genomics 2020Quote: ... High-quality sequencing libraries were constructed by following the protocol of IlluminaTruSeq™ (cat. no. FC-121-2003) DNA preparation kit (Illumina, CA, USA), then were sequenced on Hiseq2000 platform (Novogene ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed once with PBS before DNA transposition was performed with the Nextera DNA Library Prep Kit (Illumina, Cat. #FC-121-1031). Per sample ...
-
bioRxiv - Neuroscience 2019Quote: ... One ng of the pooled amplicons was used for library construction with the Nextera XT DNA library preparation kit (#FC-131-1096; Illumina, San Diego, CA), according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing amplicon pools were diluted to 0.2 ng/µl and tagmented with Nextera XT library prep kit (Illumina, Cat#FC-131-1024). Nextera libraries were dual-barcoded and sequenced on an Illumina NextSeq1000 instrument ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were resuspended in the Nextera transposition reaction mix (25 ul 2x TD Buffer, 2.5 uL Nextera Tn5 transposase (Illumina Cat #FC-121-1030), and 22.5 ul nuclease free H2O ...
-
bioRxiv - Microbiology 2021Quote: Total RNA from tissues was converted to cDNA with SuperScript IV and sequencing libraries prepared with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024). Sequencing was performed using the Illumina NextSeq platform with 150bp paired-end reads ...
-
bioRxiv - Microbiology 2019Quote: ... Tagged libraries were pooled and sequenced (300 cycles, paired-end sequencing) in the Illumina HiSeq 4000 instrument using a HiSeq 4000 SBS Kit (Illumina, FC-410-1003). Raw reads were preprocessed using the standard Illumina pipeline to segregate multiplexed reads.
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 ng of the amplified cDNA was converted into the sequencing library with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024), according to the protocol supplied ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Neuroscience 2022Quote: ... A sequencing library was produced using 0.75 ng of the amplified cDNA in the Nextera XT Library Preparation Kit (Illumina, cat # FC-131-1024). For astrocyte RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... Next the amplicons were checked for their size and purity on a 1.5 % agarose gel and if suitable subjected to the index PCR using the Nextera XT Index Kit v2 Set C/D (Illumina, FC-131-2003). After index PCR the samples were cleaned again with AmPure XP Beads (Beckman Coulter Life Science Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 pg of cDNA from each sample was used as input for library preparation with the Nextera XT DNA Library Prep Kit (Illumina FC-131-1096). Fragmentation and adaptors insertion were performed by tagmentation ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Developmental Biology 2019Quote: ... Tagmentation and library preparation was done using the Nextera XT DNA Library Prep kit and sequenced using the NextSeq 500/550 High Output Kit v2 (75 cycles) 400 million reads (Illumina, #FC-404-2005) on Illumina NextSeq 500 platform ...
-
bioRxiv - Systems Biology 2019Quote: ... Sequencing library DNA preparation was performed using the Tn5 tagmentation-based method with 1/4 volumes of the Nextera XT DNA Library Preparation Kit (Cat# FC-131-1096, −2001, −2002, −2003, and −2004, Illumina, San Diego, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2019Quote: ... 1.5 pM of pool (combined with 40% spiked-in) was loaded onto a NextSeq 500 Mid-Output Kit (150 cycles) cartridge (catalog #FC-102-1001; Illumina, San Diego, CA) for high throughput sequencing on a NextSeq 500 instrument (Illumina) ...
-
bioRxiv - Cell Biology 2019Quote: ... The resulting full-length enriched cDNA library was processed into the sequencing library using the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). The quality of the libraries was inspected by size and concentration by agarose gel electrophoresis before pooling the libraries ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA libraries with an average size of 1.5-2 kb were tagmented and indexed during a second PCR amplification step with the Illumina Nextera XT DNA preparation kit (Illumina, FC-131-1024). Tagmentation was performed according to the manufacturer’s protocol with an input of 500 pg cDNA and amplicon tagment mix for 5 min at 55 °C ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing amplicon pools were diluted to 0.2 ng/µl and tagmented with Nextera XT library prep kit (Illumina, Cat#FC-131-1024). Nextera libraries were dual-barcoded and sequenced on an Illumina NextSeq1000 instrument ...
-
bioRxiv - Genomics 2019Quote: EHVols were sequenced with the Illumina Miseq and Nextseq platforms using the Trusight Cardio Sequencing Kit (Illumina, Catalog No. FC-141-1010 (MiSeq) and FC-141-1011 (NextSeq ...
-
bioRxiv - Developmental Biology 2019Quote: ... Approximately 250pg of cDNA was used for preparation of dual-indexed libraries using the Nextera XT DNA Library Preparation Kit (Illumina # FC-131-1002) following the manufacturer’s procedures.
-
bioRxiv - Cancer Biology 2020Quote: ... and centrifuged at 500 g at 4° C to isolate nuclear pellets that were treated in 50 μL reactions with Nextera Tn5 Transposase (Illumina, FC-121-1030) for 30 min at 37° C ...
-
bioRxiv - Genetics 2021Quote: ... The nuclei were resuspended on ice in the transposition reaction mix (2x TD Buffer, 2.5μL Tn5 Transposes and Nuclease Free H2O) (Illumina Cat #FC-121-1030, Nextera) on ice and the transposition reaction was incubated at 37°C for 45 min ...
-
bioRxiv - Neuroscience 2021Quote: 1 uL of diluted cDNA per well was used for library preparation using the Nextera XT DNA Sample Prep Kit (Illumina, #FC-131-1096). Each C1 IFC was pooled into one library ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Immunology 2020Quote: ... University of Edinburgh using the NextSeq 500/550 High-Output v2 (150 cycle) Kit (# FC-404-2002) with a High Out v2.5 Flow Cell on the NextSeq 550 platform (Illumina Inc, #SY-415-1002). 8 libraries were combined in an equimolar pool based on the library quantification results and run across one High-Output Flow Cell ...
-
bioRxiv - Cell Biology 2021Quote: ... Single-indexed and multiplexed samples were run on an Illumina Next Seq 500 sequencer using a NextSeq 500 v2 kit (FC-404-2005; Illumina, Can Diago, CA) for paired-end sequencing.
-
bioRxiv - Immunology 2021Quote: ... Libraries were quantified sing Qubit High-Sensitivity DNA kit and preparation kit and libraries were constructed using Nextera XT DNA tagmentation (Illumina FC-131-1096) using 800 pg of pooled cDNA library as input using index primers with format as in Gierahn et al [46] ...
-
bioRxiv - Immunology 2022Quote: ... and pooled to form an equimolar sequencing library that was denatured and diluted to 1.2 pM with a 20% PhiX v3 control library (Illumina, Cat#FC-110-3001), as described in the Illumina Denature and Dilution protocol (Illumina ...
-
bioRxiv - Microbiology 2022Quote: Sequencing libraries were prepared from 1 ng of each VSG PCR product using the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096) following the manufacturer’s protocol except for the final cleanup step ...