Labshake search
Citations for Illumina :
701 - 750 of 1002 citations for Primary Human Melanocyte Cells since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2023Quote: ... The cDNAs from each cell were pooled and a library was generated and sequenced with a NovaSeq 6000 (Illumina). We sequenced two biological replicates to a sequencing depth of ∼1 billion reads each ...
-
bioRxiv - Synthetic Biology 2023Quote: ... RNA and plasmid DNA libraries were sequenced using a 50 cycle SP flow cell on a NovaSeq 6000 (Illumina) using custom sequencing primers (Table S4).
-
THE OLFACTORY RECEPTOR Olfr78 REGULATES DIFFERENTIATION OF ENTEROCHROMAFFIN CELLS IN THE MOUSE COLONbioRxiv - Cell Biology 2023Quote: ... before processing through the Chromium Next GEM Single Cell 3’ Reagent Kits V3.1 (10X Genomics) and sequenced on a Novaseq 6000 (Illumina).
-
bioRxiv - Neuroscience 2023Quote: ... cDNAs were prepared using the single cell 30 Protocol as per manufacturer’s instructions and sequenced on a NovaSeq instrument (Illumina) with 26 bases for read 1 and 98 bases for read 2.
-
bioRxiv - Neuroscience 2024Quote: ... Samples were sequenced to a target read depth of ∼160 million paired end reads per library (19,291 reads/cell on average) using Illumina NovaSeq (Illumina). Library preparation and sequencing were performed at the KU Leuven Genomics Core (https://www.genomicscore.be/).
-
bioRxiv - Cancer Biology 2023Quote: ... Gel-in-beads and libraries were generated using Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10x Genomics) and sequenced using NovaSeq (Illumina). Cell Ranger 7.0.1 ...
-
bioRxiv - Microbiology 2023Quote: ... Sequencing libraries were loaded onto an Illumina MiSeq using a 2×300 v3 flow cell (Illumina, San Diego, CA) and sequenced to an average depth of 87,099 reads per sample ...
-
bioRxiv - Genomics 2023Quote: ... the sequencing library was prepared with the Chromium Next GEM Single Cell ATAC Reagent Kits v1.1 (10x Genomics, CG000209) and sequenced on the NovaSeq 6000 sequencer (Illumina).
-
bioRxiv - Genomics 2023Quote: ATAC-seq libraries were prepared from 25,000 cells following the Omni-ATAC protocol 46 and using the Tagment DNA Enzyme and Buffer Kit (Illumina). Samples were pooled and run in one HiSeq lane.
-
bioRxiv - Molecular Biology 2024Quote: ... including PCR cycles (12 cycles for cDNA amplification of 5000 cells and 14 cycles for index PCR. E13.5GE libraries from Evf2+/+and Evf2TS/TS were sequenced on the Illumina NovaSeq 6000 (Sequencing Core Facility at the La Jolla Institute).
-
bioRxiv - Molecular Biology 2023Quote: ... 15000 cells/sample for mESC were treated with Tagment DNA Buffer 2x reaction buffer with Tagment DNA Enzyme (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2024Quote: ... Single-cell RNA-sequencing libraries of the cDNA were prepared using the Nextera XT DNA library prep kit (Illumina). Libraries were multiplexed and sequenced in accordance with the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2024Quote: ... Live purified CD4+ T cells were processed using OMNI-ATAC protocol and libraries sequenced using NextSeq 500 sequencer (Illumina).
-
bioRxiv - Immunology 2024Quote: ... Gene expression and surface protein libraries were generated using the Chromium Next GEM Single Cell 3 ’Reagent Kits v3.1 and sequenced by Illumina MiSeq or NextSeq2000 ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were prepared using a Chromium Single Cell 3’ Library & Gel Bead kit v2 (10x Genomics, PN-120237) and sequenced using a NextSeq 500 (Illumina). The mean number of reads per cell was approximately 25,000 and the median number of genes detected per cell was approximately 2,000.
-
bioRxiv - Microbiology 2020Quote: ... The samples were clustered on a flow cell and 50 cycle paired-end sequencing was performed on an Illumina HiSeq 2000 (Illumina).
-
bioRxiv - Developmental Biology 2021Quote: ... 75-bp single-end sequencing was performed on 12 multiplexed libraries pooled together in one flow cell using a NextSeq 500 high output sequencer (Illumina).
-
bioRxiv - Cell Biology 2020Quote: ... Totally 3 μg of total RNA was ligated with 5′- and a 3′-adaptors sequentially with TruSeqTM Small RNA (or Stranded Total RNA in the case of cancer cells) Sample Prep Kit (Illumina). Briefly ...
-
bioRxiv - Cell Biology 2020Quote: ... Purified cells were lysed in ATAC lysis buffer for 5 min to get nuclei and then transposed with Tn5 transposase (Illumina) for 30 min ...
-
bioRxiv - Cell Biology 2020Quote: ... Indexed sequencing libraries were constructed using the Chromium Single-Cell 3’ library kit (10X Genomics) and sequenced on NovaSeq 6000 (Illumina) with the following parameters ...
-
bioRxiv - Immunology 2021Quote: ... Peptides carried by the MCRs from sorted cells were amplified from cDNA by RT-PCR using the peptide flanking regions and sequenced on a miniSeq (Illumina). Sequences from the Illumina output files were trimmed ...
-
bioRxiv - Developmental Biology 2021Quote: Three samples were processed using 10X Single Cell 3’ GEX version 3 (10X Genomics) and sequenced on a NovaSeq 6000 S4 PE (Illumina) at UCLA Technology Center for Genomics & Bioinformatics ...
-
bioRxiv - Developmental Biology 2020Quote: ... Libraries were generated using Kapa Biosystems library preparation kit (#KK8201) and multiplexed libraries were sequenced on a 1×75 High output flow cell on the NextSeq550 platform (Illumina). Reads were filtered and trimmed to remove adapter-derived or low-quality bases using Trimmomatic and checked again with FASTQC ...
-
bioRxiv - Developmental Biology 2021Quote: ... Chromium Single Cell 3’ v2 single cell RNA-Seq of poly A selected mRNA kit (10X Genomics) and Sequencing was processed on NextSeq 500 (Illumina). Bioinformatics base call by bcl2fastq v ...
-
bioRxiv - Immunology 2019Quote: VH and VL libraries from sorted B cell were subjected to NGS on the MiSeq platform with the reagent kit V3 2×300 bp paired-end (Illumina), using an input concentration of 16pM with 5% PhiX.
-
bioRxiv - Developmental Biology 2022Quote: 25.000 FACS-sorted cells were collected and used for ATAC Library preparation using Tn5 Transposase from Nextera DNA Sample Preparation Kit (Illumina). The cell pellet was resuspended in 50 µl Lysis/Transposition reaction (12.5 µl THS-TD-Buffer ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... a paired-end library was constructed using Illumina DNA Prep (earlier known as Nextera DNA Flex Library Prep) and sequenced on NovaSeq 6000 (NovaSeq SP 150bp Paired-end Flow Cell, Illumina) at the Biomedical Sequencing Facility (BSF ...
-
bioRxiv - Microbiology 2020Quote: DNA extracted from the three cell lines was genotyped on the 220k semi-custom CanineHD array (Illumina, San Diego, CA). Genotype data were managed in PLINK 1.9 (www.cog-genomics.org/plink/1.9/ ...
-
bioRxiv - Immunology 2020Quote: ... and duplicate compression was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2020Quote: ... Sample demultiplexing and clonotype alignment was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Systems Biology 2019Quote: ... The libraries were hybridized to the flow-cell using TruSeq Rapid Duo cBot Sample Loading Kit (Illumina, CT-403-2001), utilising the Illumina RR_TemplateHyb_FirstExt_VR method on the Illumina cBot ...
-
bioRxiv - Microbiology 2020Quote: ... and duplicate compression was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Microbiology 2020Quote: ... and duplicate compression was performed using the Cell Ranger software package (10x Genomics, CA, v2.1.0) and bcl2fastq2 (Illumina, CA, v2.20) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2019Quote: ... 7 or up to 17 samples were multiplexed per lane and run on a 50bp single-end flow cell in a HiSeq2000 or HiSeq3000 sequencer (Illumina), respectively ...
-
bioRxiv - Immunology 2020Quote: ... Libraries were constructed from the barcoded cDNAs (Translational Science Laboratory at the Medical University of South Carolina) and sequenced for approximately 300 million reads/sample on a NovaSeq S4 flow cell (Illumina) at the VANTAGE facility (Vanderbilt University Medical Center).
-
bioRxiv - Genomics 2019Quote: ... we pooled together the single cell or nucleus libraries from different methods with normalized molar concentrations and loaded them onto a HiSeq2500 (Illumina) in the 8-lane high output or 2-lane rapid run mode to minimize the potential sequencing variation ...
-
bioRxiv - Plant Biology 2019Quote: ... The sequencing was performed with 2 x 100 bp read length of the flow cell loaded on a HiSeq 2500 sequencing system (Illumina).
-
bioRxiv - Biochemistry 2019Quote: ... The two cDNA libraries from RNAs of Cfdp1-K1 or dvR2-4 cells were prepared using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Their sequences were obtained using NovaSeq 6000 S4 Reagent Kit by a Nova Sequencing system (S1 Appendix ...
-
bioRxiv - Genomics 2020Quote: The forward indexing primer sequence is - AATGATACGGCGACCACCGAGATCTACAC[i5]TCGTCGGCAGCGTC and the reverse indexing primer sequence is - CAAGCAGAAGACGGCATACGAGAT[i7]GTCTCGTGGGCTCGG (where the bolded regions are the p5 and p7 flow cell adapters and [i5] and [i7] refer to the index sequence codes used by Illumina). The qPCR step starts with an initial denaturing step at 95 °C for 5 min followed by 35 cycles of denaturation (20s at 98 °C) ...
-
bioRxiv - Bioengineering 2020Quote: ... The barcoded amplicon samples were then sent to the UCLA Technology Center for Genomics & Bioinformatics for multiplex sequencing with 2 x 300 paired-end configuration in a single-lane flow cell of MiSeq instrument (Illumina). Fastq paired-end raw data were filtered ...
-
bioRxiv - Genetics 2021Quote: We merged fastq files from the same library when sequenced on multiple flow cells and trimmed the adapters using sequences provided by Illumina with Cutadapt/1.1562 ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were pooled and sequenced single-end for 75 cycles on one high-output flow cell of an Illumina NextSeq with 5% PhiX control (Illumina) added to provide sequence diversity ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were single end (75bp) or pair-end sequenced at 36 bp by 36 bp on a Nextseq550 flow cell (Illumina).
-
bioRxiv - Systems Biology 2020Quote: ... The pools were clustered on a single read flow cell and sequenced for 50 cycles on a HiSeq 4000 sequencer (Illumina). CASAVA (v2.20 ...
-
bioRxiv - Neuroscience 2020Quote: ... single cell and/or nucleus libraries were run using paired-end sequencing with single indexing on the HiSeq 4000 platform (Illumina) by following manufacturer’s instructions (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... Libraries were multiplexed on two high-output flow cells and sequenced (using 75 bp reads) on a NextSeq 500 device (Illumina). The mean ± standard deviation (SD ...
-
bioRxiv - Genetics 2020Quote: ... The cell pellet was resuspended with 50 μl transposition mix containing 25 μl 2X TD buffer (Illumina FC-121-1030), 3.5 μl Tn5 transposase (Illumina FC-121-1030) ...
-
bioRxiv - Microbiology 2020Quote: ... A reference genome from strain QMA0248 was constructed using both long reads derived from a single Smrt Cell using the PacBio RS II system with P4C2 chemistry and short reads from Illumina HiSeq2000 derived from Nextera XT paired-end libraries as reported elsewhere (NCBI accession no ...
-
bioRxiv - Plant Biology 2020Quote: ... sequencing was performed with Illumina NovaSeq 6000 system using S4 flow cell with lane divider (Illumina, San Diego, CA, USA). Read length for the paired-end run was 2×151 bp ...
-
bioRxiv - Neuroscience 2020Quote: ... cDNA was diluted to an average of 200 pg/µl and 100 pg cDNA from each cell and was tagmented using Nextera XT DNA Library Preparation Kit (Illumina). The tagmentation reaction was incubated at 55 °C for 8 min before removing Tn5 from the DNA by adding 0.5 µl NT buffer per well ...