Labshake search
Citations for Illumina :
701 - 750 of 1318 citations for 6β Fluoro 21 hydroxypregna 1 4 9 11 16 tetraene 3 20 dione 21 acetate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Molecular Biology 2023Quote: Trimmomatic version 0.39 was employed to trim reads after a quality drop below a mean of Q20 in a window of 20 nucleotides and keeping only filtered reads longer than 15 nucleotides (Bolger et al., Trimmomatic: a flexible trimmer for Illumina sequence data). Reads were aligned versus Ensembl human genome version hg38 (Ensembl release 104 ...
-
bioRxiv - Cell Biology 2023Quote: RNA libraries were prepared using 200 ng of total RNA in 20 µl according to the manufacturer’s instructions for the Illumina Stranded mRNA Ligation Sample Prep Kit (Illumina, San Diego, CA). The concentration and size distribution of the completed libraries were determined using an Agilent Bioanalyzer DNA 1000 chip and Qubit fluorometry (Invitrogen) ...
-
bioRxiv - Genetics 2023Quote: ... We finally added dual indexing primers using the i5 and i7 system from Illumina (NEB Q5 for 20 cycles, Tm 65 °C). We then performed a bead cleanup ...
-
bioRxiv - Molecular Biology 2022Quote: ... or purified chromosomes (2 x 106 pelleted at 10,000g for 10min at 4°C) were resuspended in 50 μl transposase mixture (25 μl Illumina TD buffer ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Molecular Biology 2019Quote: ... 4 nM of this pool were loaded on a high output flowcell and sequenced on a NextSeq500 platform (Illumina) with 2×75nt paired-end chemistry.
-
bioRxiv - Systems Biology 2019Quote: ... We sequenced to a depth of at least 500,000 reads per RNA sequencing library (with a typical depth of around 4 million reads) on a NextSeq500 (Illumina). While we targeted 48 clones and 48 controls for each cell line ...
-
bioRxiv - Immunology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2022Quote: ... Library pools were diluted to 4 nM and denatured into single strands using fresh 0.2 N NaOH as recommended by Illumina. The final library was loaded at a concentration of 8 pM ...
-
bioRxiv - Microbiology 2023Quote: ... Libraries were pooled into a 4 nM solution and sequenced on the Illumina MiSeq platform (Illumina; San Diego; CA) with a target sequencing yield of 500MB-1GB per virome.
-
bioRxiv - Neuroscience 2023Quote: ... 4 saline) were pooled at equimolar concentrations and run with 75 bp paired-end reads on the MiSeq (Illumina).
-
bioRxiv - Evolutionary Biology 2021Quote: ... we combined 3 μl of each sample (approx 2.24 ng) with a small quantity of a Nextera™ tagment DNA enzyme (Illumina catalogue #15027865). To decrease costs ...
-
bioRxiv - Microbiology 2021Quote: ... The libraries were sequenced using an Illumina MiSeq with MiSeq Reagent Kit v.3 (2x 300 bp, Illumina, San Diego, CA, USA) according to manufacturer’s instructions.
-
bioRxiv - Cell Biology 2022Quote: ... The quantitative 3-step real-time PCR was performed by the Eco Real-Time PCR system (Illumina Inc., San Diego CA, USA) and CFX Connect (Bio-Rad Laboratories AG ...
-
bioRxiv - Genetics 2019Quote: ... with the European individuals from the 1000G phase 3 reference panel and from the Human Genome Diversity Panel data30 (HGDP, Illumina HuHap 650k), to generate four genome-wide SNP datasets analyzed independently.
-
bioRxiv - Immunology 2019Quote: Single-cell RNA-sequencing libraries were generated using the 10x Genomics Single Cell 3’ Solution (version 2) kit and sequenced to an average depth of > 200k reads/cell (Illumina HiSeq 4000). Data analysis was performed using Python3 pipelines (https://github.com/sansomlab/tenx ...
-
bioRxiv - Cancer Biology 2021Quote: ... RNA-seq libraries were constructed using a QuantSeq 3’mRNA-Seq Library Prep Kit (LEXOGEN, Vienna, Austria) and sequenced with the NextSeq500 (Illumina, CA, USA) to generate a minimum of two million single-end 75-bp reads ...
-
bioRxiv - Genomics 2021Quote: ... and Reverse primer (5’-GTC TCG TGG GCT CGG AGA TGT GTA TAA GAG ACA GGA CTA CHV GGG TAT CTA ATC C-3’) with Illumina sequencing adaptors (Illumina, California, USA). The purified PCR products were then subjected to a multiplexing process using Nextera XT Index kit (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... all of the ChIP DNA and 220 ng of input DNA were mixed with 3 units of T4 DNA polymerase (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) to create blunt ends ...
-
bioRxiv - Genomics 2023Quote: ... WGS of the samples of Batch 3 was commercially performed by Eurofins (Germany) using Genome Sequencer Illumina NovaSeq platform (Illumina, California, USA) (paired-end 150 bp reads).
-
bioRxiv - Synthetic Biology 2024Quote: ... and a reverse primer annealing to the intronic region directly 3’ of the J segment (PCR1 Rev primer with Illumina adapter overhang). PCRs were performed with Q5 High-fidelity DNA polymerase (NEB ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA from approximately 15-20 progeny per mutant were pooled and sequencing libraries were prepared with a Nextera kit (Illumina, FC-121-1030). All whole genome sequencing data is available on NCBI SRA (accession #PRJNA526508) ...
-
bioRxiv - Microbiology 2019Quote: ... The PCR products of each sample were mixed to a final concentration of 20 pmol and then sequenced with a MiSeq benchtop sequencer (Illumina, San Diego, USA) for 2×300 bp paired-ends sequencing.
-
bioRxiv - Genetics 2021Quote: ... homokaryotic mutants were crossed to a genetically polymorphic Mauriceville strain and approximately 15-20 antibiotic-resistant progeny were pooled and prepared for whole genome sequencing using the Nextera kit (Illumina, FC-121-1030). Mapping of the critical mutations was performed as previously described (Hunter 2007 ...
-
bioRxiv - Neuroscience 2020Quote: ... 50bp RNA-seq of IP fractions and total homogenate from 5 replicates per cell type (20 samples total) was performed on a single lane of a HiSeq 3000 (Illumina, San Diego, California), yielding ∼350M reads ...
-
bioRxiv - Genetics 2020Quote: ... one unit of input was diluted to 30 μl and mixed with 50 μl of 2x TD buffer and 20 μl of TDE (Illumina 20034197, Lot 20436911), and incubated at 55 °C for 10 min (Note ...
-
bioRxiv - Genomics 2019Quote: ... and 800 bp) and four mate-pair libraries (2, 6, 10, and 20 Kb) following the standard protocols provided by Illumina (San Diego, USA). Subsequently ...
-
bioRxiv - Cancer Biology 2020Quote: ... and sequenced on Illumina next-generation sequencing platforms with a 20% spike-in of PhiX control DNA (Illumina, cat. no. FC-110-3001). All sequencing runs used a dual-index configuration and a custom Read 1 primer (5’ GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAG 3’ ...
-
bioRxiv - Immunology 2022Quote: ... and pooled to form an equimolar sequencing library that was denatured and diluted to 1.2 pM with a 20% PhiX v3 control library (Illumina, Cat#FC-110-3001), as described in the Illumina Denature and Dilution protocol (Illumina ...
-
bioRxiv - Cancer Biology 2023Quote: ... of libraries were pooled and subjected to sequencing of approximately 20 million reads per sample using the Mid Output v2 kit (Illumina, FC-404-2001) on a Illumina NextSeq550 following the manufacturer’s instructions.
-
bioRxiv - Microbiology 2023Quote: ... The diluted library was combined with the subsequent PhiX control v3 (20%, v/v) and loaded onto a MiSeq v2 (500 cycles) reagent cartridge (Illumina, Carlsbad, CA, USA). The resulting sequences were uploaded to BaseSpace (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... about 1.5 ng purified pre-amplified cDNA sample was fragmented in four 20 μl tagmentation mix (10 μl 2x TD buffer, 5 μl Nextera XT (Illumina, FC-131-1096), and 5 μl cDNA sample ...
-
bioRxiv - Systems Biology 2023Quote: ChIP-seq and input libraries were sequenced on the Illumina NextSeq 500 system with a ∼20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Microbiology 2023Quote: ... The pooled library (600 μL at 20 picomolar) was denatured and sequenced on an Illumina MiSeq sequencer (Illumina Inc., San Diego, CA, US).
-
bioRxiv - Cancer Biology 2021Quote: ... The captured libraries were sequenced to achieve a mean unique coverage of at least 1000x using Illumina v.4 chemistry and paired-end 100-base pair (bp) reads (HiSeq, Illumina).
-
bioRxiv - Cancer Biology 2021Quote: ... The flow cell underwent cluster amplification and massively parallel sequencing by synthesis using Illumina v.4 chemistry and paired-end 100-bp reads (Illumina).
-
bioRxiv - Immunology 2021Quote: Paired-end RNA-Sequencing was performed on two independent biological replicates of 10 or 12 pooled 4-dpf larval zebrafish per genotypic group (nlrc3l mutants versus their siblings) by Illumina HiSeq 2×100 basepairs ...
-
bioRxiv - Microbiology 2020Quote: ... A total of 4 pools were sequenced on the Illumina MiSeq using the 600-cycle MiSeq Reagent Kit V3 (Illumina). Each pool contained 3 identical samples to assess sequencing run variations.
-
bioRxiv - Genomics 2019Quote: ... RNAseq libraries were pooled and sequenced via single end 50 bp reads on a HiSeq 2500 (4 libraries per lane) or HiSeq 4000 (6 libraries per lane)(Illumina).
-
bioRxiv - Molecular Biology 2019Quote: ... Bisulfite converted DNA (4 ul) was analyzed in a balanced design using Infinium Human Methylation 450 BeadChip Arrays (Illumina, Inc.) per manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2019Quote: ... The two cDNA libraries from RNAs of Cfdp1-K1 or dvR2-4 cells were prepared using the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina). Their sequences were obtained using NovaSeq 6000 S4 Reagent Kit by a Nova Sequencing system (S1 Appendix ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were sequenced using 2 x 150 nt paired-end sequencing runs (4 lanes on separate runs) on NextSeq Genome Sequencer (Illumina) with a NextSeq 500/550 High Output Kit v2.5 at Core Facility for Scientific Research – University of Sao Paulo (CEFAP-USP).
-
bioRxiv - Microbiology 2020Quote: ... Libraries diluted to 4 nM were sequenced with NextSeq 500 High Output Kit v2 (75 cycles) on a NextSeq 500 (Illumina). Small RNA libraries have been submitted to the NCBI sequence read archive (SRA ...
-
bioRxiv - Genomics 2021Quote: ... Nuclei were then collected by centrifuging at 500 x g for 10 min at 4°C and nuclei were resuspended in 50 μL of transposition reaction mix [25 μL 2X TD buffer (Illumina), 16.5 μL PBS ...
-
Enhancer Remodeling Promotes Tumor-Initiating Activity in NRF2-Activated Non-Small Cell Lung CancersbioRxiv - Cancer Biology 2020Quote: ... 4 μg of total RNA from A549 cells was subjected to rRNA removal using the Ribo-Zero Gold kit (Illumina). cDNA sequencing libraries were then prepared using the SureSelect Strand-Specific RNA library preparation kit (Agilent Technologies ...
-
bioRxiv - Genomics 2021Quote: Final samples for both inverse PCR and UMI-amplicons (concentration 4 nM) were sequenced as paired-end reads on HiSeq2500 and NextSeq500 sequencers (Illumina).
-
bioRxiv - Developmental Biology 2022Quote: ... stage-matched comparisons comprising a total of 5 control and 4 Mesp1 KO embryos were ultimately re-pooled and sequenced together for deep sequencing on a NovaSeq6000 S4 lane (Illumina). All libraries were sequenced to depths of at least 24,000 median fragments per cell ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... Each pool was sequenced 100 bp single-end on two flow cells of a HiSeq2500 sequencer using the HiSeq SBS sequencing kit version 4 (Illumina). Sequencing was conducted in two separate HiSeq runs to yield enough coverage per sample and later combined ...
-
bioRxiv - Genomics 2023Quote: ... all samples were pooled at 4 nm concentration and paired-end [300bp (2 × 151bp)] sequenced in MiSeq platform (Illumina, USA).