Labshake search
Citations for Illumina :
651 - 700 of 9126 citations for Human Adenosylhomocysteinase Like 1 AHCYL1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2021Quote: The Nextera DNA Library Prep Kit (Illumina) was used to prepare sequence libraries with 25 ng of input DNA ...
-
bioRxiv - Genomics 2020Quote: ... RNA Library Prep Kit v2 from Illumina® (Illumina Inc. ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the TruSeq stranded mRNA kit (Illumina) to enrich for polyadenylated transcripts ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... mid Output 150 cycles kits (Illumina®) for 2 × 75 bp PE reads ...
-
bioRxiv - Microbiology 2021Quote: ... the Ribo-Zero rRNA removal kit (Illumina) was used without deviations from the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... using a MiSeq v3 Reagent Kit (Illumina) and 2 × 300 bp paired end sequencing ...
-
bioRxiv - Immunology 2021Quote: ... using the v3 MiSeq Reagent Kit (Illumina). 16S data were analyzed using QIIME 2 (3) ...
-
bioRxiv - Molecular Biology 2021Quote: ... TruSeq SBS Kit v3-HS (Illumina, USA).
-
bioRxiv - Immunology 2020Quote: ... with the Ribo-Zero Gold kit (Illumina) for ribosomal depletion ...
-
bioRxiv - Immunology 2020Quote: ... employing Illumina MiSeq v2 Reagent Kit (Illumina). For the analysis of TCR sequencing data ...
-
bioRxiv - Immunology 2020Quote: ... Indices from the Nextera Index Kit (Illumina), followed by adaptors P1 (AATGATACGGCGACCACCGA ...
-
bioRxiv - Microbiology 2021Quote: ... with HiSeq Rapid SBS kit v2 (Illumina), generating paired-end reads up to 250 bp ...
-
bioRxiv - Genetics 2019Quote: ... and Index Kit (Illumina FC-131-1001), according to the standard manufacturer protocol ...
-
bioRxiv - Genomics 2021Quote: ... purified for library preparation (Illumina Library Kit), and deep-sequencing with 200 million tags through Illumina HiSeq2500 sequencer.
-
bioRxiv - Genomics 2021Quote: ... rRNA was depleted using RiboZero kit (Illumina). NGS-libraries were generated using NEBnext Ultra II directional RNA library prep kit for Illumina and sequenced as PE75 reads on an Illumina NextSeq550.
-
bioRxiv - Genomics 2021Quote: KAPA Hyper Prep Kits from Illumina (KK8500) were used to construct the library with a slight modification to the manufacturer’s protocol ...
-
bioRxiv - Immunology 2022Quote: ... using the TruSeq SBS Kit v3 (Illumina). An average of 40 million paired reads were generated per sample ...
-
bioRxiv - Developmental Biology 2022Quote: ... 2.5μl Transposase enzyme (Illumina Nextera kit, 15028252) and 22.5μl Nuclease-free water in a total of 50uL reaction for 1 hour at 37°C ...
-
bioRxiv - Immunology 2022Quote: ... TruSeq Stranded mRNA Library Prep kit (Illumina) was used to assess transcript abundance following standard instructions from the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: ... the TruSeq stranded RNA kit (Illumina Inc.) was used according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2023Quote: ... The Kapa Hyper Prep kit (for Illumina) was used for sequencing library preparation ...
-
bioRxiv - Microbiology 2022Quote: ... Multiplexing Sample Preparation Oligonucleotide Kit from Illumina, Inc ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and Nextera XT index kit D (Illumina). Amplicon sizes were verified on a Tapestation using the High Sensitivity D1000 Screentape (Agilent) ...
-
bioRxiv - Molecular Biology 2022Quote: ... and Ribo-Zero rRNA removal kit (Illumina). After purifying RNA ...
-
bioRxiv - Cancer Biology 2022Quote: ... tagmentation (Nextera DNA Sample Preparation Kit, Illumina) and library preparation was performed ...
-
bioRxiv - Neuroscience 2022Quote: ... The TruSeq RNA Sample Prep Kit (Illumina) was used for library preparation from all samples ...
-
bioRxiv - Immunology 2023Quote: ... and Nextera XT library prep kit (Illumina) with an input of 10ng of RNA per sample ...
-
bioRxiv - Microbiology 2023Quote: ... using TruSeq SBS Kit v3 - HS (Illumina) for 50 cycles ...
-
bioRxiv - Genomics 2023Quote: The Nextera XT Index Kit (Illumina inc.) was used to construct the libraries ...
-
bioRxiv - Microbiology 2023Quote: ... using a MiSeq Reagent kit v3 (Illumina) following the standard guidelines for preparing and loading samples on the MiSeq ...
-
bioRxiv - Neuroscience 2023Quote: ... and purified with a RiboZero kit (Illumina). The resulting mRNA fragment inserts were then reverse transcribed to first strand cDNA using reverse transcriptase and random primer in the presence of actinomycin D ...
-
bioRxiv - Molecular Biology 2023Quote: ... the TruSeq Small RNA Prep Kit (Illumina) was used to prepare small RNA libraries from RNA pyrophosphohydrolase (Rpph ...
-
bioRxiv - Microbiology 2023Quote: ... the TruSeq Stranded Library Preparation kit (Illumina) was used to prepare the sequencing library ...
-
bioRxiv - Microbiology 2023Quote: ... A TruSeq DNA Library Preparation Kit (Illumina) was used for cDNA library preparation ...
-
bioRxiv - Molecular Biology 2023Quote: ... The NexteraXT DNA Library Preparation Kit (Illumina) was used to generate sequencing libraries (1/5th of the recommended volume) ...
-
bioRxiv - Developmental Biology 2023Quote: ... the TruSeq stranded mRNA kit protocol (Illumina) was followed to make libraries ...
-
bioRxiv - Immunology 2023Quote: ... using a NextSeq P3 sequencing kit (Illumina) with a target depth of 5 million reads per sample ...
-
bioRxiv - Molecular Biology 2023Quote: ... TruSeq RNA Library Prep Kit v2 (Illumina) was used to prepare a whole-transcriptome sequencing library and sequenced on one lane of a NovaSeq 6000 SP (Illumina ...
-
bioRxiv - Microbiology 2023Quote: ... the Illumina TruSeq Stranded mRNA kit (Illumina) was used to build the null mutant and IP libraries ...
-
bioRxiv - Genetics 2023Quote: ... the TruSeq DNA Methylation Kit (Illumina Inc.) was used ...
-
bioRxiv - Cancer Biology 2023Quote: ... using TruSeq ChIP Sample Preparation Kit (Illumina) or ThruPLEX® DNA-seq Kit (Rubicon Genomics ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... Illumina Nextera kit (Illumina, San Diego, CA) was used for library preparation and the samples were sequenced with NextSeq 550 platform ...
-
bioRxiv - Genomics 2023Quote: The Nextera XT Index Kit (Illumina Inc.) was used for the first amplicon generation followed by NGS library preparation of the QC passed samples ...
-
bioRxiv - Genomics 2023Quote: ... the TruSeq Ribo Profile (Mammalian) Kit (Illumina) was used in accordance with the manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2023Quote: ... libraries were prepared using TruSeq Kit (Illumina). RNA-sequencing (30 million reads per sample ...
-
bioRxiv - Bioengineering 2023Quote: ... Illumina TruSeq RNA stranded kit (Illumina, US) was used for library preparation ...
-
bioRxiv - Cancer Biology 2022Quote: The TruSight Oncology 500 Kit (TSO500, Illumina) was used for DNA library preparation and enrichment following the manufacturer’s protocol ...
-
bioRxiv - Immunology 2023Quote: ... Libraries were barcoded (Nextera Index Kit, Illumina) and amplified with NEBNext High Fidelity PCR Mix (New England Biolabs) ...
-
bioRxiv - Microbiology 2023Quote: ... using the MiSeq Reagent Kit v3 (Illumina) and paired-end 300bp chemistry ...
-
bioRxiv - Immunology 2023Quote: ... using the TruSeq SBS Kit v4 (Illumina). An average of 42 million paired reads were generated per sample and the percent of mRNA bases per sample ranged from 73% to 84%.