Labshake search
Citations for Illumina :
651 - 700 of 975 citations for Goat Anti Human IgG Fc Alkaline Phosphatase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2024Quote: ... Libraries were then pooled and sequenced with a NextSeq 500/550 Mid Output v2 kit (150 cycles) according to the manufacturer’s recommendation (Illumina, FC-404-2001). Pooled samples were run in triplicate for a minimum sequencing depth of 20 million reads per sample ...
-
bioRxiv - Microbiology 2023Quote: ... The NGS library was prepared with the Nextera XT DNA Library prep kit following manufacturer’s instructions with changes (Illumina #FC-131-1096). Initially ...
-
bioRxiv - Immunology 2023Quote: ... 150 picograms of cDNA was used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina catalog#: FC-131-1024). Libraries were quantified with Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific catalog# ...
-
bioRxiv - Bioengineering 2024Quote: ... The resulting cell nuclei were subjected to incubation for 30 min with Tagment DNA TDE1 Enzyme and Buffer (Illumina, #FC-121-1030). This step fragmented the chromatin and inserted sequencing adapters ...
-
bioRxiv - Cancer Biology 2023Quote: ... 4) tagmentation was performed with 2ng input and sequencing library generated using the Nextera XT library prep kit (Illumina, #FC-131-1024). In short ...
-
bioRxiv - Genomics 2023Quote: HMW DNA from 1.5 x 106 cells was used to generate Illumina libraries with the Nextera XT DNA Library Preparation kit (Illumina FC-131-1024) and Illumina DNA PCR-Free Library Prep ...
-
bioRxiv - Cancer Biology 2021Quote: ... these analyses were performed on a Human HT-12-v4 BeadChip (Illumina) after labeling (Ambion ...
-
bioRxiv - Neuroscience 2020Quote: ... The Illumina Human CytoSNP-12v2.1 BeadChip array and KaryoStudio analysis software (Illumina) were used to assess genome integrity (Supplementary Table 1).
-
bioRxiv - Molecular Biology 2020Quote: ... with ribosomal depletion using Human/Mouse/Rat Ribo-Zero kit (Epicentre/Illumina). All samples were sequenced using a 100 base-pair (bp ...
-
bioRxiv - Genomics 2022Quote: ... we benchmarked 23 different human genotyping arrays including 14 arrays from Illumina and 9 arrays from Affymetrix ...
-
bioRxiv - Genomics 2020Quote: ... Illumina TruSeq Stranded Total RNA Ribo-Zero Human/Mouse/Rat Gold (Illumina) was used to construct ribosomal RNA depleted sequencing libraries ...
-
bioRxiv - Molecular Biology 2019Quote: ... Trimmed reads were mapped to the human genome (hg38 downloaded from Illumina iGenomes on August 8th ...
-
bioRxiv - Pharmacology and Toxicology 2020Quote: ... DNA methylation was quantified using Infinium Human Methylation 27 BeadChip (Illumina, CA) at the Northwestern University Core facility.
-
bioRxiv - Genetics 2021Quote: ... whereas the Illumina Human HT-12 v4 beadchip (Illumina, San Diego, CA) is a genome-wide array targeting about 31,000 genes (with on average 2 probes per gene ...
-
bioRxiv - Genomics 2021Quote: ... DNA methylation levels were measured using Infinium Human Methylation 450 arrays (Illumina) according to the manufacturer’s protocol.
-
bioRxiv - Developmental Biology 2023Quote: ... TruSeq Stranded Total RNA with Ribo-Zero Human/Mouse/Rat kit (Illumina) was used to prepare RNA-seq libraries according to manufacturer’s protocol ...
-
bioRxiv - Genetics 2024Quote: ... or in the Human Imprintome array BeadChip (Illumina, Inc., San Diego, CA), amplified ...
-
bioRxiv - Cell Biology 2023Quote: ... RNase H or the Ribo-Zero method (human, mouse, plants) (Illumina, USA) was used to remove rRNA ...
-
bioRxiv - Cancer Biology 2024Quote: Genomic DNA was analyzed using Infinium Human Methylation 450K BeadChip system (Illumina), as described [91] ...
-
bioRxiv - Developmental Biology 2021Quote: ... ATAC-seq libraries for murine endothelial cells were processed as previously described (Buenrostro et al., 2015) and libraries were generated using the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030). The quality of purified DNA libraries was checked by Agilent High Sensitivity DNA kit (Agilent Technologies) ...
-
bioRxiv - Microbiology 2021Quote: ... Jude Children’s Research Hospital Hartwell Center with DNA libraries prepared using Nextera XT DNA-Seq library prep kits (Illumina, cat#FC-131-1024) with 96 dual-index bar codes and sequenced on an Illumina MiSeq personal genome sequencer ...
-
bioRxiv - Developmental Biology 2020Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using a custom primer and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 pM and sequencing configuration as following ...
-
bioRxiv - Developmental Biology 2021Quote: Approximately 50,000 nephron progenitor cells were used to generate each sequencing library for the assay for transposase-accessible chromatin (ATAC-seq) using the Nextera DNA Flex Library Prep Kit (Illumina FC-121-1030) with modifications according to a previously published method (Buenrostro et al. ...
-
bioRxiv - Genomics 2022Quote: ... One ng of the pooled amplicons was used for library construction with the Nextera XT DNA library preparation kit (#FC-131–1096; Illumina, San Diego, CA), according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... Beads were resuspended in 25 μl of 2X TD Buffer and combined with Tn5 enzyme from the Nextera DNA Sample Preparation Kit (Illumina, FC-121-1030) and water to final volume 50 μl ...
-
bioRxiv - Molecular Biology 2021Quote: ... and 2.5 µl of each Nextera Index 1 (N7XX) and Nextera Index 2 (N5XX) primers from a Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011). PCR was performed according to the following protocol ...
-
bioRxiv - Molecular Biology 2021Quote: ... The beads were resuspended in 50 μl of the following PCR master mix with indexed primers from the Nextera DNA Sample Preparation Index Kit (Illumina, FC-121-1011): Phusion HF 2X (NEB ...
-
bioRxiv - Molecular Biology 2020Quote: ... The resulting library was diluted to 10-pM in 600-μL of HT1 hybridization buffer (Illumina Nextera XT kit Cat#FC-131-1024) and 10-μL was loaded onto a 300-cycle MiSeq Nano v2 flow cell (Illumina Cat#MS-102-2002 ...
-
bioRxiv - Molecular Biology 2019Quote: ... Genomic DNA from approximately 15-20 progeny per mutant were pooled and sequencing libraries were prepared with a Nextera kit (Illumina, FC-121-1030). All whole genome sequencing data is available on NCBI SRA (accession #PRJNA526508) ...
-
bioRxiv - Genomics 2020Quote: ... The dissolved DNA was then tagmented using 0.6 μl TD Tagmentation buffer and 0.3 μl ATM Tagmentation enzyme from Nextera DNA Library Prep Kit (Illumina, catalog no. FC-121-1030) for 5min at 55 °C ...
-
bioRxiv - Microbiology 2019Quote: ... 2 µL of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina Catalogue No. FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Genomics 2019Quote: ... Four libraries were paired-end sequenced (75 nt each) with the NextSeq 500 using the Mid Output v2 kit (150 cycles) (Illumina, #FC-404-2001).
-
bioRxiv - Genomics 2019Quote: ... prior to pooling and sequencing using the Illumina NextSeq 500 platform using custom ReadOne primer (IDT) and the High Output v2 kit (75 cycles) (Illumina, #FC-404-2005). The library loading concentration was 2.2 nM ...
-
bioRxiv - Genomics 2019Quote: ... the nuclei pellets were resuspended in transposase Master Mix (1.25 μl 10x TD buffer, 5 μl H2O and 6.5 μl of Tn5: Illumina Nextera Kit; FC-121-1031) and incubated for 30 minutes at 37°C ...
-
bioRxiv - Genetics 2021Quote: ... homokaryotic mutants were crossed to a genetically polymorphic Mauriceville strain and approximately 15-20 antibiotic-resistant progeny were pooled and prepared for whole genome sequencing using the Nextera kit (Illumina, FC-121-1030). Mapping of the critical mutations was performed as previously described (Hunter 2007 ...
-
bioRxiv - Genomics 2020Quote: ... High-quality sequencing libraries were constructed by following the protocol of IlluminaTruSeq™ (cat. no. FC-121-2003) DNA preparation kit (Illumina, CA, USA), then were sequenced on Hiseq2000 platform (Novogene ...
-
bioRxiv - Immunology 2021Quote: ... Cells were washed once with PBS before DNA transposition was performed with the Nextera DNA Library Prep Kit (Illumina, Cat. #FC-121-1031). Per sample ...
-
bioRxiv - Neuroscience 2019Quote: ... One ng of the pooled amplicons was used for library construction with the Nextera XT DNA library preparation kit (#FC-131-1096; Illumina, San Diego, CA), according to the manufacturer’s guidelines ...
-
bioRxiv - Neuroscience 2020Quote: ... indexing and amplification of the transposed DNA samples was performed by combining 10 µL of transposed DNA with the following: 5 µL of the Nextera i5 and i7 indexed amplification primers (Nextera Index Kit, Illumina, FC-121-1011), 25 μl of the NEBNext High-Fidelity 2x PCR Master Mix (New England Biolabs ...
-
bioRxiv - Microbiology 2021Quote: ... The sequencing amplicon pools were diluted to 0.2 ng/µl and tagmented with Nextera XT library prep kit (Illumina, Cat#FC-131-1024). Nextera libraries were dual-barcoded and sequenced on an Illumina NextSeq1000 instrument ...
-
bioRxiv - Genomics 2019Quote: ... Nuclei were resuspended in the Nextera transposition reaction mix (25 ul 2x TD Buffer, 2.5 uL Nextera Tn5 transposase (Illumina Cat #FC-121-1030), and 22.5 ul nuclease free H2O ...
-
bioRxiv - Microbiology 2021Quote: Total RNA from tissues was converted to cDNA with SuperScript IV and sequencing libraries prepared with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024). Sequencing was performed using the Illumina NextSeq platform with 150bp paired-end reads ...
-
bioRxiv - Microbiology 2019Quote: ... Tagged libraries were pooled and sequenced (300 cycles, paired-end sequencing) in the Illumina HiSeq 4000 instrument using a HiSeq 4000 SBS Kit (Illumina, FC-410-1003). Raw reads were preprocessed using the standard Illumina pipeline to segregate multiplexed reads.
-
bioRxiv - Cell Biology 2021Quote: ... 0.6 ng of the amplified cDNA was converted into the sequencing library with the Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1024), according to the protocol supplied ...
-
bioRxiv - Cancer Biology 2022Quote: ... Samples were sequenced using a custom sequencing primer (GCGACCACCGAGATCTACACACTGACTGCAGTCTGAGTCTGACAG) and the NextSeq® 500/550 Mid Output Kit v2 - 150 cycles (FC-404-2001, Illumina, CA, USA) on the Illumina NextSeq® platform.
-
bioRxiv - Neuroscience 2022Quote: ... A sequencing library was produced using 0.75 ng of the amplified cDNA in the Nextera XT Library Preparation Kit (Illumina, cat # FC-131-1024). For astrocyte RNA-seq ...
-
bioRxiv - Microbiology 2021Quote: ... Next the amplicons were checked for their size and purity on a 1.5 % agarose gel and if suitable subjected to the index PCR using the Nextera XT Index Kit v2 Set C/D (Illumina, FC-131-2003). After index PCR the samples were cleaned again with AmPure XP Beads (Beckman Coulter Life Science Cat ...
-
bioRxiv - Neuroscience 2021Quote: ... 300 pg of cDNA from each sample was used as input for library preparation with the Nextera XT DNA Library Prep Kit (Illumina FC-131-1096). Fragmentation and adaptors insertion were performed by tagmentation ...
-
bioRxiv - Cancer Biology 2022Quote: ... Post-ligation cleanup proceeded according to Illumina’s instructions with 110 µL Sample Purification Mix from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina catalog # FC-151-1002). After purification ...
-
bioRxiv - Developmental Biology 2019Quote: ... Tagmentation and library preparation was done using the Nextera XT DNA Library Prep kit and sequenced using the NextSeq 500/550 High Output Kit v2 (75 cycles) 400 million reads (Illumina, #FC-404-2005) on Illumina NextSeq 500 platform ...