Labshake search
Citations for Illumina :
6751 - 6800 of 10000+ citations for Cow Putative Phospholipase B Like 2 PLBD2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Plant Biology 2022Quote: ... cDNA library construction (TrueSeq Standard mRNA LT Sample Prep Kit) and sequencing (100 bp paired reads using Illumina.NovaSeq6000) were done by Macrogen company (Korea).
-
bioRxiv - Plant Biology 2022Quote: ... One μg of genomic DNA was used for library construction with the Truseq DNA PCR-free kit (Illumina) following the manufacturer’s instructions for 350 bp insert size ...
-
bioRxiv - Molecular Biology 2022Quote: ... and ligation of full-length barcoded Illumina adapters was performed using the TruSeq DNA PCR-free kit (Illumina) according to the manufacturer’s guidelines ...
-
bioRxiv - Immunology 2022Quote: ... RNA-Seq libraries were prepared using the Illumina TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA) and sequenced on an Illumina HiSeq 2500 Sequencer (Illumina ...
-
bioRxiv - Microbiology 2022Quote: ... Each sample was made compatible for deep sequencing using the Nextera XT DNA sample preparation kit (Illumina, USA). Specifically ...
-
bioRxiv - Immunology 2022Quote: ... High-resolution 4-digit HLA typing was performed with the TruSight HLA v2 Sequencing Panel kit from Illumina according to the manufacturer instruction ...
-
bioRxiv - Microbiology 2022Quote: ... DNA library was prepared using the Nextera XT DNA Library Prep Kit (Illumina Inc., San Diego, CA, USA), normalized using quantitation-based procedure ...
-
bioRxiv - Microbiology 2022Quote: ... Ribosomal RNA was removed from total RNA using the Ribo Zero Gold for human/mouse/rat kit (Illumina). Using the TruSeq RNA Sample Library Preparation v.2 kit (Illumina) ...
-
bioRxiv - Microbiology 2022Quote: ... Genomic DNA libraries were prepared with TruSeq DNA PCR-Free sample preparation kit (Illumina Inc., San Diego, USA) and 2Ͱ×Ͱ150 paired-end sequencing was performed using the NextSeq 500/550 Illumina technology (Illumina ...
-
bioRxiv - Systems Biology 2022Quote: ... 1 ng of cDNA was “tagmented” and bar coded using a Nextera XT DNA Sample Preparation Kit (Illumina). The final libraries were purified using AmPure XP magnetic beads (Beckman Coulter ...
-
bioRxiv - Plant Biology 2022Quote: ... Illumina sequencing library was prepared using a Nextera DNA Flex Library Prep Kit (Illumina Inc, San Diego, CA) using the protocol recommended by the manufacturer ...
-
bioRxiv - Neuroscience 2022Quote: Sequencing libraries were prepared using the Illumina Nextera XT DNA Sample Preparation kit (Illumina, Ref. FC-131-1096) and the combination of 384 Combinatorial Dual Indexes (Illumina-Set A to D ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA-seq library was prepared using the TruSeq TM RNA sample preparation Kit from Illumina (San Diego, CA), using 1 μg of total RNA for each sample ...
-
bioRxiv - Plant Biology 2022Quote: One paired-end library was generated using Illumina TruSeq DNA sample preparation kit (Illumina, San Diego, CA, USA), following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... RNA-seq libraries were prepared using the Illumina TruSeq Stranded Total RNA library Prep Gold Kit (Illumina 20020598) and TruSeq RNA Single Indexes (Illumina ...
-
bioRxiv - Microbiology 2023Quote: Libraries for Illumina sequencing were prepared using a Nextera XT DNA Library Preparation Kit (Illumina, San Diego, USA) with modifications according to Baym (Baym et al ...
-
bioRxiv - Neuroscience 2023Quote: Total RNA was used for removal of ribosomal RNA (rRNA) using Ribo-Zero rRNA Removal Kits (Illumina, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries for RNA-seq were prepared using the Illumina TruSeq RNA library Prep Kit (RS-122-2001, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and 1ug of total RNA was used to prepare RNA-seq libraries with TruSeq Stranded mRNA kit (Illumina), and the libraries were sequenced on Illumina NovaSeq 6000 instruments.
-
bioRxiv - Genetics 2022Quote: ... Sequencing was performed using NextSeq 500/550 High-Output v2.5 (150 cycle) kit on NextSeq 550 platform (Illumina). Libraries were combined into a single equimolar pool of 12 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were prepared from 500 pg of cDNA with a Nextera XT DNA Library Prep kit (Illumina). Libraries were paired-end sequenced at 75×75 bases on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: RNA sequencing of hippocampal tissue was carried out using TruSeq Stranded Total RNA kit and protocols (Illumina, US). A 1ug aliquot of total RNA from each hippocampus was prepared for RNA sequencing ...
-
bioRxiv - Physiology 2022Quote: ... Sequencing libraries were generated from 0.5 µg of total RNA using TruSeq Stranded Total RNA preparation kit (Illumina) as per manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and a unique combination of the dual-barcoded primers P5 and P7 Nextera XT Index kit (Illumina #15055293). The cycling conditions were ...
-
bioRxiv - Molecular Biology 2022Quote: Small RNA libraries were made using the Illumina TruSeq Kit following the manufacturer’s protocol (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... ChIP-seq libraries were prepared by the Montpellier MGX platform (https://www.mgx.cnrs.fr) using TruSeq®ChIP Sample Preparation kits (Illumina). The sequencing was processed on Hi-SEQ 2000 (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Gene expression and barcode libraries were prepared in parallel using the Chromium Next GEM Single Cell 3’ Kit v3.1 (10x Genomics) according to manufacturer’s instructions and sequenced in a Novaseq 6000 system (Illumina). A detailed step-by-step protocol can be found on protocols.io ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sequencing libraries were constructed from 100 ng total RNA using a Truseq stranded mRNA Library Prep Kit (Illumina) without the poly-A selection step ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA sequencing was performed on an Illumina NextSeq500 platform (SBS50 kit, high-output mode, Illumina, San Diego, CA) using default parameters for paired-end sequencing (76bp + 9bp) ...
-
bioRxiv - Microbiology 2022Quote: ... Whole genome metagenomic libraries were prepared at LLNL using the Illumina DNA Flex library kit (now called Illumina DNA Prep ...
-
bioRxiv - Molecular Biology 2022Quote: ... 1ug of input RNA was subjected to rRNA depletion with the Ribo-Zero Glod Yeast kit (MRZY1324, Illumina) following manufacturer instructions.
-
bioRxiv - Developmental Biology 2022Quote: ... and depleted of rRNA using the Ribo-Zero Magnetic Kit HMN/Mouse/Rat 24 Rxn (Illumina; Cat# MRZH11124) according to the manufacturer’s protocol using a low input protocol with 2-4µL rRNA removal solution yielding a 20µL final sample volume added to 90µL magnetic beads ...
-
bioRxiv - Immunology 2022Quote: ... Thermo) and a sequencing library was constructed using the Illumina TruSeq RNA Library Prep for Enrichment kit (Illumina). The sequencing library was enriched for SARS-CoV-2 using the Twist Respiratory Virus Research Panel (Twist) ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA-seq libraries of polyA+-selected samples were prepared using TruSeq Stranded mRNA Library Preparation Kit LT (Illumina). After quality control ...
-
bioRxiv - Immunology 2022Quote: ... libraries were sequenced by Novaseq 6000 platform running Novaseq 6000 S4 Reagent Kit v1.5 300 cycles (Illumina, 20028312) or NovaSeq XP 4-Lane Kit v1.5 (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Enrichment of DNA fragments was performed as described for Illumina TruSeq Nano DNA LT Kit (Illumina, Cat#: 20015964). Sample clean up was performed with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: Library preparation was performed using the tagmentation based Illumina DNAFlex Library Prep kit (Illumina, San Diego, CA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were quantified using the Universal Library Quantification Kit (KAPA) before sequencing on a NextSeq 550 system (Illumina) at the Institute for Research in Immunology and Cancer (IRIC ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA libraries were prepared using the TrueSeq Stranded Total RNA Sample Preparation kit with Ribo-Zero Plus (Illumina) according to the manufacturer’s protocol and sequenced thereafter via paired-end with the NovaSeq 6000 platform (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... A cDNA library was prepared from each RNA sample using the Illumina TruSeq RNA library preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... prior to generating individual indexed libraries each from 1 μg RNA using the Stranded mRNA Prep kit (Illumina), as recommended ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA library of the collected RNA samples was obtained using the TruSeq RNA Library Prep kit from Illumina. Single-end RNA Sequencing was performed on an Illumina HiSeq 2500 Next Generation Sequencing instrument ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced on a NextSeq 550 using a NextSeq 500/550 High Output v2.5 75 cycle kit (Illumina) using custom sequencing primers NP0494-NP0497 ...
-
bioRxiv - Pathology 2024Quote: ... RNA-seq transcriptome libraries were prepared following the NEB Next Ultra RNA Library Prep Kit from Illumina (NEB). NEB Next Poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... All RNA-seq libraries (strand-specific, paired end) were prepared with the TruSeq RNA sample prep kit (Illumina). One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Cell Biology 2023Quote: ... The nuclear pellet was resuspended in transposition reaction mix using the Tagment DNA Enzyme and Buffer Kit (Illumina) as per manufacturer protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Then the libraries were constructed using TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions and sequenced on an Illumina HiSeq X Ten platform and 150 bp paired-end reads were generated ...
-
bioRxiv - Physiology 2024Quote: ... Ribosomal RNA was removed from samples using the Ribo-Zero rRNA removal kit (Illumina, San Diego, CA, USA). Sequencing libraries were prepared using the TruSeq RNA Library Preparation Kit v2 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The libraries were then subjected to paired end sequencing on Illumina Nextseq using Nextseq Mid Output kit (Illumina) with a read length of 150 bp ...