Labshake search
Citations for Illumina :
601 - 650 of 928 citations for Recombinant Mouse Jam2 Fc tagged since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cell Biology 2020Quote: ... and DNA libraries for sequencing were constructed using Nextera XT DNA Library Prep kit (FC-131-1024, Illumina, San Diego, CA). The 24 prepared libraries were pooled and submitted to Michigan State University Genomics Facility ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were prepared based on a 20X scaled-down Nextera XT DNA Library Prep Kit (Illumina, Cat. No. FC-131-1024) protocol (35 ...
-
bioRxiv - Genomics 2021Quote: ... and 8.8 µl of paired i7 and i5 Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001) were added to each Tagmentation reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... Tagmentation by Tn5 was performed using reagents from the Nextera DNA Sample Preparation Kit (FC-121-1030, Illumina; San Diego, CA) as previously described [5] ...
-
bioRxiv - Genomics 2020Quote: ... and sequenced on an Illumina NextSeq 500 (NextSeq control software v2.0.2/Real Time Analysis v2.4.11) using a 150-cycle NextSeq 500/550 High Output Reagent Kit v2 (Illumina, FC-404-2002) in standalone mode as follows ...
-
bioRxiv - Immunology 2021Quote: ... single reads and 7 bases index read on an Illumina HiSeq2000 instrument using the TruSeq SBS Kit HS-v3 (50-cycle, FC-401-3002, Illumina Inc). RNA seq data in FASTQ form from each sample were first quality assessed using fastQC ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were resuspended in 50 ul of the transposase reaction buffer (Nextera DNA library prep kit (Illumina cat. FC-121- 1030) and 22.5 ul nuclease-free water ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Tagmentation by Tn5 was performed using reagents from the Nextera DNA Sample Preparation Kit (FC-121-1030, Illumina; San Diego, CA) as previously described (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... multiplex sample pool (1.5pM including PhiX 1.5%) was loaded in NextSeq 500/550 High Output v2 Kit (75 cycles) cartridge (Illumina; FC-404-1005) and loaded on NextSeq 500 System Machine (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-10 ng of the full-length cDNA was used as input for preparing Nextera XT (Illumina, cat. # FC-131-1024) libraries following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 μL Tn5 transposase and 22.5 μL ddH2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 4 nM library pools were diluted and denatured to 1.3 pM and dual index sequenced on an Illumina Miniseq using a Miniseq Mid Output 300 cycle Reagent kit (FC-420-1004, Illumina, USA). High quality Miniseq runs produced > 2.0Gb ...
-
bioRxiv - Plant Biology 2023Quote: ... libraries were prepared from 2 µg of total RNA using the TruSeq RNA Sample Prep Kit (Illumina, Cat # FC- 122-1001) and sequenced on the HiSeq 4000 to produce at least 18 million 50 bp single-end reads.
-
bioRxiv - Biophysics 2023Quote: ... 100-120 μl pooled-denatured 20 pM library and 10-20 μl 20 pM PhiX control library (Illumina, FC-110-3001) to provide a reasonable spot density in general ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genomics 2023Quote: ... Samples were then loaded onto the Illumina NextSeq500 Instrument using a Mid-output 300 cycle kit (Illumina Catalogue FC-404-2003) or the MinION flow cell ONT instrument (R9.4.1) ...
-
bioRxiv - Microbiology 2023Quote: The Acinetobacter isolates libraries were prepared with the Nextera XT DNA Library preparation kit from Illumina (Cat. No.: FC-131-1096) and were sequenced with the NextSeq 550 instrument (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... The denatured library with a final loading concentration of 400 pM in a pool was loaded on the S4 FC using Illumina SBS kits (Illumina, 20012866) with the following setting on the NovaSeq 6000 ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Cancer Biology 2024Quote: ... which was eluted and processed as described in the SPLiT-seq protocol using the Nextera XT kit (Illumina #FC-131-1024) to generate the final RNA derived cDNA SPLiT-seq libraries [9] ...
-
bioRxiv - Microbiology 2021Quote: The genomes of imipenem-resistant recombinants of M2 which had acquired blaOXA-23 were sequenced on a Novaseq instrument (Illumina, 2 × 150 bp paired-end ...
-
bioRxiv - Developmental Biology 2020Quote: Libraries were sequenced on an Illumina HiSeq X™ using HiSeq X™ Five Reagent Kit v2(Illumina, Cat# FC-502-2021).
-
bioRxiv - Synthetic Biology 2022Quote: ... Indexes were added to the amplified DNA using i5 and i7 primers from the Nextera XT Index Kit (Illumina # FC-131-1002). Indexed samples were loaded into a MiSeq Reagent Kit v3 600-cycle (Illumina # MS-102-3003 ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for sequencing using 1 ug of genomic DNA following the TruSeq PCR free kit protocol (Illumina, FC-121-3001). Resulting libraries were quality checked on an Agilent DNA 1000 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA libraries were single-end sequenced in 76 cycles using a NextSeq 500 Kit v2 (FC-404-2005, Illumina, San-Diego, CA). High-throughput sequencing was performed using NextSeq500 sequencing system (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Illumina short reads were assembled into contigs in two steps ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2.5 µL Tn5 transposase and 22.5 µL nuclease-free H2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Genomics 2020Quote: ... 2000 and underwent a 50 cycle single read sequence run with TruSeq SBS Kit v3-HS reagents (Illumina, Cat. FC-401-3002). The raw sequence reads were aligned to the reference genome using STAR (version 2.7.3a) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A total of 140 pg of the amplified cDNA was fragmented using Nextera XT DNA sample preparation kit (Illumina FC-131-1096) and amplified with Nextera XT indexes (Illumina FC-131-1001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Genomics 2019Quote: ... Tagmentation of cDNA was performed and sequencing libraries were prepared using the Nextera XT DNA sample preparation kit (Illumina, FC-131-1096) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Second, the pellet was resuspended in the transposase reaction mix (25 μl 2× TD buffer, 2.5 μl transposase (Illumina, FC-121-1030) and 22.5 μl nuclease-free water) ...
-
bioRxiv - Genomics 2020Quote: ... 2 µl each of P7 and P5 Nextera XT Index Kit v2 index primers (Illumina Catalogue numbers FC-131-2001 to 2004) were added to each well ...
-
bioRxiv - Cell Biology 2020Quote: ... cDNA was diluted 1:15 and subsequently tagmented and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina FC-131). Individual libraries were QC’d by Qubit and Agilent Bioanalyzer ...
-
bioRxiv - Genomics 2019Quote: ... libraries were prepared according to the manufacturer’s instructions with a 1% spike-in of the ϕX174 control library (Illumina #FC-110-3002) and sequenced on an Illumina NextSeq 500 instrument with a High Output v2 reagent kit (Illumina #FC-404-2005) ...
-
bioRxiv - Microbiology 2021Quote: ... 2 µL each of P7 and P5 of Nextera XT Index Kit v2 index primers (catalogue No. FC-131-2001 to 2004; Illumina, Cambridge, UK) were also added to each well ...
-
bioRxiv - Immunology 2020Quote: ... The cell pellets were resuspended in 50 μl transposition mix (25 μl 2X TD buffer, 2.5 μl transposase (Illumina, FC-121-1030), 16.5 μl PBS ...
-
bioRxiv - Cell Biology 2021Quote: ... Libraries were diluted to a final concentration of 2.8 pM in HT1 buffer (supplemented with the kit) and loaded on 75-cycle high-output flow cells (Illumina, FC-404-2005) and sequenced on a NextSeq 550 (Illumina) ...
-
bioRxiv - Genetics 2019Quote: ... 300 pg of each sample was enzymatically fragmented and indexed using a Nextera XT DNA Library Preparation Kit (Illumina FC-131-1024), and Index Kit (Illumina FC-131-1001) ...
-
bioRxiv - Molecular Biology 2020Quote: ... The cell pellet was resuspended in 50 μl transposition mix (25 μl 2X TD buffer, 2.5 μl transposase (Illumina, FC-121-1030), 16.5 μl PBS ...
-
bioRxiv - Genomics 2019Quote: ... as per the manufacturer’s instructions and sequenced on an Illumina NextSeq500 machine with 13 libraries pooled at 1.8 pM using one High Output Kit v2 (Illumina #FC-404-2005) with 75 cycles single-end.
-
bioRxiv - Microbiology 2022Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Finally ...
-
bioRxiv - Molecular Biology 2023Quote: ... 100 000 nuclei were subjected to Tn5 transposition reaction using 2.5 μl TDE1 from Nextera DNA Library Prep Kit (Illumina, #FC-121-1030). After adding the transposition reaction mix ...
-
bioRxiv - Microbiology 2023Quote: ... The sequencing libraries were prepared using a modified protocol for the Nextera XT DNA library preparation kit (Illumina Inc. FC-131-1024). The genomic DNA was fragmented ...
-
bioRxiv - Genomics 2023Quote: ... Two biological replicates of 7.5 × 104 cells for each condition were then isolated for direct processing with Nextera Tn5 enzyme (Illumina, FC-131-1096). Samples were treated as previously described (77 ...
-
bioRxiv - Cell Biology 2023Quote: ... Sequencing adaptors were added by tagmentation and amplified for 12 cycles using the Nextera XT DNA Library Preparation Kit (Illumina, # FC-131). Libraries were pooled at a final concentration of 1.35 pM ...
-
bioRxiv - Biochemistry 2023Quote: ... Paired-end sequencing libraries were generated from each dsDNA sample using the Nextera XT DNA Library Preparation Kit (Illumina FC-131-1024) exactly as recommended by the manufacturer ...
-
bioRxiv - Microbiology 2023Quote: ... Samples were diluted to a concentration of 0.2 ng/µL and sequencing libraries were prepared using the Nextera XT Library Prep protocol (Illumina FC-131-1024). M-RTPCR and library preparation was performed in duplicate for all viral RNA ...