Labshake search
Citations for Illumina :
601 - 650 of 1539 citations for Diethyl 2 chlorothiazol 5 yl methylphosphonate since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2024Quote: ... This is based on the index-hopping rate of about 0.1-2% as listed by Illumina (https://sapac.illumina.com/techniques/sequencing/ngs-library-prep/multiplexing/index-hopping.html).
-
bioRxiv - Genomics 2023Quote: ... RNA-seq (2 × 100 nt paired-end reads) was performed using a HiSeq 3000 instrument (Illumina), yielding an average of 38 million reads/sample.
-
bioRxiv - Immunology 2023Quote: ... RNA-seq libraries were sequenced at read lengths 2 × 151bp on the Illumina Novaseq 6000 (Illumina). Aligment was performed using RNA-STAR (2.3.1 ...
-
bioRxiv - Systems Biology 2023Quote: They performed 2 × 50 bp paired-end sequencing on the NextSeq 2000 platform (Illumina Inc, #20038897) using NextSeq 1000/2000 P2 Reagents (100 cycles ...
-
bioRxiv - Molecular Biology 2023Quote: ... Paired end sequencing (2 x 150bp) was carried out on an Illumina Nextseq or Novaseq (Illumina).
-
bioRxiv - Genetics 2024Quote: ... Libraries were sequenced in 2×38-bp paired-end mode with NextSeq 500 sequencing technology (Illumina), per the manufacturer’s recommendations.
-
bioRxiv - Microbiology 2023Quote: ... 2×125 bp paired-end library preparation and WGS analysis on a HiSeq 2500 platform (Illumina) was performed by BaseClear (Leiden ...
-
bioRxiv - Molecular Biology 2023Quote: ... Sequencing was performed in a 2×75 bp paired-end configuration using a NovaSeq platform (Illumina).
-
bioRxiv - Microbiology 2023Quote: ... All libraries were pooled and sequenced on a NextSeq 2K P1 2×150-bp run (Illumina) with 20% PhiX target spiked in to account for the low diversity of Tn-seq libraries ...
-
bioRxiv - Cancer Biology 2022Quote: ... Resulting DNA libraries were pooled at 10 nM and sequenced in 2 × 76-bp format (Illumina), resulting in >35 million read pairs per library.
-
bioRxiv - Microbiology 2022Quote: ... was used to sequence the library with a 2×300 bp cycle with 15% PhiX (Illumina). All raw sequence data have been deposited in the NCBI SRA (accession number pending).
-
bioRxiv - Genetics 2023Quote: ... All purified amplicons (25 µL) were submitted for MiSeq sequencing (Illumina, paired-end, 2×300 bp) to Eurofins Genomics (Germany).
-
bioRxiv - Genomics 2023Quote: We sequenced one elephant reference genome (Em538) to ~60× (2 lanes of Illumina Hiseq X Ten) coverage and eight additional female genomes (4 Asian and 4 African ...
-
bioRxiv - Immunology 2023Quote: Isolated phage DNA was sequenced at the Naval Medical Research Center using MiSeq (2×300bp) (Illumina). Whole genome assembly was performed using SPAdes and CLCBio genome workbench ...
-
bioRxiv - Genomics 2023Quote: ... Each individual received a unique barcode before multiplexing individuals (Illumina NovaSeq 6000; 2×150bp PE lane).
-
bioRxiv - Cell Biology 2023Quote: ... Paired-end 150 × 2 sequencing was performed by Novogene (Sacramento, CA) using a NovaSeq 6000 (Illumina).
-
bioRxiv - Genetics 2023Quote: ... Paired-end sequencing (2 × 150 bases) of these amplicons was performed using an iSeq 100 (Illumina).
-
bioRxiv - Microbiology 2023Quote: The prepared libraries were sequenced (2×100 bp paired-end sequencing) on the HiSeq 2500 (Illumina) platform ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2-3 ng of DNA was used as input for TruSeq ChIP Library Preparation Kit (Illumina) with following modifications ...
-
bioRxiv - Neuroscience 2023Quote: ... DNA methylation profiling for cohorts 2 and 3 were performed using the Infinium HumanMethylationEPIC BeadChip (Illumina). Sample processing steps and detailed methodology have been described previously [8,14] ...
-
bioRxiv - Microbiology 2023Quote: ... was applied with S2 flow cells and the 2 x 150 bp paired-end kit (Illumina) according to company protocols ...
-
bioRxiv - Plant Biology 2024Quote: ... cDNA libraries were prepared with Illumina TruSeq RNA Sample Preparation Kit v.2 (Illumina, United States) from the extracted RNA ...
-
bioRxiv - Cancer Biology 2024Quote: ... Sequencing was performed with the NovaSeq sequencing system using the 2 x 150 bp protocol (Illumina).
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were run on a NovaSeq6000 in 150 bp x 2 paired-end mode (Illumina, Japan) at the OIST Sequencing Center ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... The paired-end sequencing (150 bp × 2) was performed using the Novaseq6000 next-generation sequencer (Illumina). The rRNAs were removed from the total RNAs using the Ribo-Zero Plus rRNA Depletion Kit (Illumina) ...
-
bioRxiv - Microbiology 2024Quote: ... Shotgun metagenome sequencing was performed on an Illumina NovaSeq 6000 sequencer (2 × 150 bp) (Illumina, USA).
-
bioRxiv - Immunology 2024Quote: ... Next-generation sequencing libraries were prepared with the TruSeq RNA Library Prep kit v.2 (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2024Quote: ... Indexes were added by PCR (Table 2) using the Nextera IDT UD Set D (Illumina 20027213) for multiplex sequencing ...
-
bioRxiv - Systems Biology 2024Quote: ... and 40 million 2×100 bp paired-end reads were generated per sample using RTA (Illumina) for base calling ...
-
bioRxiv - Plant Biology 2024Quote: The second PCR and the amplicon sequencing (Illumina V3 kit: 2 × 300 bp paired-end reads) were performed by the Genome Transcriptome Facility of Bordeaux according to standard protocols.
-
bioRxiv - Neuroscience 2024Quote: ... in a case of scRNAseq and 2×151 bp on NovaSeq 6000 (Illumina, San Diego, USA) in a case of RNAseq.
-
bioRxiv - Genomics 2024Quote: ... pair-end sequencing (2*150) of each sample was performed on an Illumina platform (Illumina, USA).
-
bioRxiv - Genetics 2021Quote: ... The pellet was resuspended in 10 µL of transposition mixture (5 µL TD buffer, 3.2 µL PBS, 0.89 µL Tn5 (Illumina, 20034197), 0.1% Tween-20 ...
-
bioRxiv - Molecular Biology 2021Quote: ... The V4 region was amplified using 0.5 ng of DNA extracted from F and LL and the universal primer pairs 515F and 806R (underlined nucleotides in the following sequences) designed to contain from 5′ to 3′ ends the transposon Nextera’s sequences (Nextera DNA sample preparation guide, Illumina): 515F ...
-
bioRxiv - Genomics 2020Quote: ... Sequencing libraries were prepared according to the TruSeq stranded mRNA library preparation kit (Illumina, Inc., Cat No.20020594/5) including poly-A selection ...
-
bioRxiv - Genomics 2020Quote: ... Next nuclei were pelleted and the transposition reaction was performed incubating the lysate for 30 min at 37 °C under agitation in the presence of Transposition mixture (Tris-HCl pH 7.6 10 mM, MgCl2 5 mM, dimethyl formamide 10%, Tn5 enzyme 100 nM – Illumina #20018704 ...
-
bioRxiv - Genetics 2020Quote: ... Globin and rRNA sequences were depleted from up to 5 µg of treated RNA using Globin-Zero Gold (Illumina), before PolyA selection with NEBNext Poly(A ...
-
bioRxiv - Systems Biology 2021Quote: ... 5 µg fragmented RNA was used for ribosomal RNA removal using Ribo-Zero Gold rRNA Removal Kit (MRZG12324 Illumina) according to Illumina’s protocol for TruSeq Ribo Profile Kit (RPHMR12126 ...
-
bioRxiv - Microbiology 2021Quote: ... 5 µL of the sample was then further diluted and denatured with 5 µL 0.1N NaOH and 490 µL HT1 buffer (Illumina). Samples were sequenced on a HiSeq2500 HighOutput (Illumina ...
-
bioRxiv - Microbiology 2021Quote: ... 5 μl of the 4nM library pool was denatured with 5 μl 0.2N of NaOH and diluted using the HT1 Hybridization Buffer (Illumina) to a concentration of 8 pM for amplicon samples and 10 pm for whole-genome samples ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 PCR cycles).Gene expression ...
-
bioRxiv - Cancer Biology 2022Quote: ... a third PCR was performed with a generic forward PCR primer (P5_generic, 5’ – AATGATACGGCGACCACCGAGATCTACAC – 3’) to retain the CB and UMI together with an RPI-x primer (Illumina) to complete the P7 end of the library and add a sample index (6 cycles) ...
-
bioRxiv - Genomics 2021Quote: ... We collected nuclei by centrifuging at 500 g at 4°C and resuspended nuclei in 5 ul TD buffer with 2.5 ul Tn5 enzyme (Illumina Tagment DNA TDE1 Enzyme and Buffer Kits) ...
-
bioRxiv - Cancer Biology 2021Quote: ... libraries were pooled equimolarly in two separate 5’ and 3’ pools and sequenced on a MiSeq Desktop Sequencer (Illumina).
-
bioRxiv - Molecular Biology 2022Quote: ... The chromatin was then tagmented by resuspending beads in 29 µl Tagmentation Buffer (10 mM Tris-HCl pH 8.0, 5 mM MgCl2, 10% dimethylformamide) and adding 1 µl of transposase (Illumina). Samples were incubated at 37 °C for 10 min and the reaction was terminated by adding 150 µl RIPA buffer ...
-
bioRxiv - Pathology 2022Quote: ... Finally, the libraries of multiplexes (control, 5 samples; schizophrenia, 10 samples) were pooled and analyzed using Illumina HiSeq1500 (Illumina).
-
bioRxiv - Genetics 2022Quote: ... Nuclei pellet was obtained by centrifugation at 500g for 5 minutes at 4 degrees and resuspended in 100μl ice-cold 1x TD buffer (20034198, Illumina). About 10K nuclei was used for transposition reaction at 37 degrees for 30 minutes in a thermomixer ...
-
bioRxiv - Genetics 2020Quote: ... and IV-5) individuals were genotyped using the Infinium Global Screening Array-24 v1.0 BeadChip (Illumina, SanDiego, CA, USA) according to manufacturer’s protocols ...
-
bioRxiv - Developmental Biology 2021Quote: ... Dual indexed sequencing libraries were made out of 5 ng cDNA from the above preparations using Illumina Nextera library preparation kit according to manufacturer’s instructions (Illumina). Quality checked and equimolar pooled libraries were sequenced in a HiSeq 4000 Illumina system ...
-
bioRxiv - Cell Biology 2020Quote: ... rRNA was depleted from 5 μg of total RNA using the Ribo-Zero Gold Yeast rRNA Removal Kit (Illumina) according to the manufacturer’s protocol ...