Labshake search
Citations for Illumina :
551 - 600 of 1391 citations for ssc mir 487b RT PCR Primer Set since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Developmental Biology 2022Quote: ... 1 μg of total RNA from each sample was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat. No. RS-122-2101, Illumina) according to the manufacturer’s instruction ...
-
bioRxiv - Molecular Biology 2024Quote: ... Extracted total RNA was send to Azenta Life Sciences for library preparation (sRNA: NEBNext Small RNA Library Prep Set for Illumina; mRNA: NEBNext Ultra II RNA Library Prep Kit for Illumina) and paired-end Illumina sequencing (NovaSeq 2×150bp).
-
bioRxiv - Molecular Biology 2024Quote: ... Extracted total RNA was send to Azenta Life Sciences for library preparation (sRNA: NEBNext Small RNA Library Prep Set for Illumina; mRNA ...
-
bioRxiv - Developmental Biology 2023Quote: 1 μg of total RNA was used from each group to prepare the mRNA libraries using TruSeq Stranded mRNA Library Preparation Kit Set A (Cat. No. RS-122-2101, Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... PCR reactions (Nextera XT, Illumina) and another round of 0.6X purification using AMPure XP beads (Beckman Coulter) ...
-
bioRxiv - Microbiology 2021Quote: ... BarSeq PCR followed by Illumina MiSeq sequencing was performed ...
-
bioRxiv - Evolutionary Biology 2019Quote: TruSeq DNA PCR-Free (Illumina) sequencing libraries were prepared ...
-
bioRxiv - Immunology 2024Quote: ... PCR products were indexed (Illumina), pooled and sequenced on an MiSeq machine (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... The libraries were amplified with 10 PCR cycles using the FailSafe PCR enzyme (Illumina/Epicentre). Libraries were quality controlled on a TapeStation 2200 HSD1000.
-
bioRxiv - Genetics 2021Quote: ... Illumina’s non-redundant unique dual indexes (UDI) were used in this step (IDT for Illumina Nextera DNA Unique Dual Indexes Set C, Illumina Inc.). Indexed PCR amplicons were purified using HighPrep PCR Clean-up magnetic beads (MagBio Genomics ...
-
bioRxiv - Microbiology 2021Quote: ... 16S amplicon libraries were prepared by addition of Nextera XT Index Kit v2 Set A adapter sequences (Illumina, San Diego, CA) which were cleaned using KAPA Pure Beads (Roche ...
-
bioRxiv - Cancer Biology 2020Quote: ... We used summarized log-scale intensities representing copy number profiles generated by combining probe intensities from four platforms (Agilent Human Genome CGH Microarray 44A, Nimblegen HG19 CGH 385K WG Tiling v2.0, Affymetrix GeneChip Human Mapping 500k Array Set and Illumina Human1Mv1_C BeadChip). A threshold of ≥ 0.9 and ≤ -0.9 was used to call copy number gains and losses ...
-
bioRxiv - Genetics 2019Quote: ... Second-strand cDNA synthesis was used to assemble a library and sequenced following the manufacturer’s instructions (NEB Next DNA Library Prep Master Mix Set for Illumina; NEB E6040L). Sequenced reads were aligned to the human reference genome hg19 using TopHat v2.1.0 with the ‘--no-coverage-search --read-realign-edit-dist 0’ option selected (17) ...
-
bioRxiv - Cell Biology 2020Quote: ... libraries for sequencing were prepared from using the TrueSeq RNA Sample Prep Kit v2-Set B (Illumina, San Diego, CA, US) according to the manufacturer’s instructions ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... and dual-indexed with Nextera XT Index Kit V2 Sets A-D (FC-131-2001, FC-131-2002, FC-131-2003, FC-131-2004, Illumina, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Cell Biology 2020Quote: ... and RNAseq libraries were prepared using in-house compatible Tn5 and Nextera index primers (Illumina, USA). Following a final clean-up ...
-
bioRxiv - Developmental Biology 2021Quote: ... Final library concentrations were determined by qPCR using custom primers and exogenously added PhiX DNA (Illumina) to generate a concentration reference curve ...
-
bioRxiv - Cancer Biology 2020Quote: ... The libraries were indexed and amplified with Illumina i5/i7 indexing primers (FC-121-1011, Illumina) by PCR reaction to reach a target concentration of 4 nM in 20 μl ...
-
bioRxiv - Microbiology 2021Quote: ... Metagenomic libraries were prepared with the Nextera XT DNA Library Prep Kit and index primers (Illumina) using the protocol developed by Rinke et al ...
-
bioRxiv - Genomics 2021Quote: ... The sequencing libraries were generated using Tn5 transposase (18) and Nextera XT dual index primers (Illumina) and then performed on the HiSeq 2500 system.
-
bioRxiv - Genomics 2022Quote: ... 2 μl of each P7 and P5 of Nextera XT Index Kit v2 index primers (Illumina) were added to each well ...
-
bioRxiv - Cancer Biology 2023Quote: ... appropriate sequence primer sites and adapters were added for sequencing on a NextSeq 500 sequencer (Illumina). After sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of the forward and reverse fusion primers (10 µM; including Illumina sequencing adapters; SI6), 2 µl of the cleaned-up PCR product ...
-
bioRxiv - Neuroscience 2023Quote: ... the tagmented DNA was amplified using Illumina primers (NEBNext® Multiplex Oligos for Illumina, NEB #7335S) with the following cycling conditions ...
-
bioRxiv - Cancer Biology 2023Quote: Libraries were constructed with the TruSeq Stranded mRNA Library Prep with Unique Dual Index Primers (Illumina) and sequenced on an Illumina NovaSeq instrument using the 2 × 50bp protocol to a depth of approximately 25M reads per sample ...
-
bioRxiv - Molecular Biology 2024Quote: ... Libraries were sequenced on an Illumina MiSeq or NovaSeq using custom sequencing primers (R1 - U6-Illumina-seq2 - TCTTCCGATCTCTTGTGGAAAGGACGAAACACCG and R2 - iScaffold-Illumina-seq3 - GCTCTTCCGATCTGCTGTTTCCAGCATAGCTCTTAAAC)
-
bioRxiv - Cancer Biology 2021Quote: ... 7.5 μL NPM PCR mix (Illumina), 4 μL distilled water ...
-
bioRxiv - Genetics 2021Quote: ... TruSeq DNA PCR Free kit (Illumina) was used for the whole-genome sequencing library preparation ...
-
bioRxiv - Immunology 2021Quote: PCR amplifications (pooled Illumina amplicon sequencing) were run with Q5 polymerase (New England Biolabs ...
-
bioRxiv - Evolutionary Biology 2019Quote: ... Library preparation (Illumina TruSeq with PCR) and paired-end genomic sequencing were conducted at the Genome Quebec Innovation Centre at McGill University on the Illumina HiSeq2000 PE100 platform ...
-
bioRxiv - Microbiology 2022Quote: ... Eco Real-Time PCR System (Illumina), qTOWER3 G Real-Time System (Analytik Jena ...
-
bioRxiv - Genetics 2020Quote: ... PCR products were analysed by Illumina Miseq 250 bp pair-end sequencing at the Genome Research Center ...
-
bioRxiv - Microbiology 2020Quote: Eco Real-Time PCR System (Illumina), from here “Eco_RT”
-
bioRxiv - Microbiology 2022Quote: ... Eco Real-Time PCR System (Illumina), qTOWER3 G Real-Time System (Analytik Jena ...
-
bioRxiv - Microbiology 2022Quote: ... Eco Real-Time PCR System (Illumina), qTOWER3 G Real-Time System (Analytik Jena ...
-
bioRxiv - Microbiology 2022Quote: ... Eco Real-Time PCR System (Illumina), qTOWER3 G Real-Time System (Analytik Jena) ...
-
bioRxiv - Microbiology 2023Quote: ... Eco Real-Time PCR System (Illumina), qTOWER3 G Real-Time System (Analytik Jena) ...
-
bioRxiv - Genetics 2023Quote: PCR products were sequenced by Illumina MiSeq sequencing ...
-
bioRxiv - Molecular Biology 2023Quote: ... Eco Real-Time PCR system (Illumina) was used for qPCR analysis with Thunderbird SYBR qPCR Mix (Toyobo) ...
-
bioRxiv - Microbiology 2023Quote: ... Eco Real-Time PCR System (Illumina), qTOWER3 G Real-Time System (Analytik Jena ...
-
bioRxiv - Genetics 2021Quote: We converted the published set of 13,037,955 loci (derived from whole-genome short-read Illumina sequencing using Illumina HiSeq 2000 by [33]) into VCF format ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... PC2 were explained by the sequencing platform and not the geographic origin of samples (Additional File1: Figure S1A; PC1 separates the SwAsp collection in two sets, each corresponding to a different Illumina sequencing platform). To address these batch effects ...
-
bioRxiv - Genomics 2021Quote: ... The best replicate from each tissue was selected for the transcriptome data set by preparing TrueSeq libraries (Illumina, San Diego, CA, USA). The rest of the samples were prepared with the Lexogen QuantSeq 3’mRNA kit (Lexogen ...
-
bioRxiv - Genomics 2022Quote: ... all of the ChIP DNA and 220 ng of input DNA were mixed with 3 units of T4 DNA polymerase (NEBNext® DNA Library Prep Master Mix Set for Illumina, #E6040L) to create blunt ends ...
-
bioRxiv - Molecular Biology 2023Quote: ... Libraries were constructed from 800 ng total RNA (NEBNext Multiplex Small RNA library prep set for Illumina, New England Biolabs, NEB-E7560S) and the small RNA fraction was sequenced on the NextSeq 500 System (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... libraries were constructed from 1000 ng total RNA (NEBNext Multiplex Small RNA library prep set for Illumina, NEB-E7560S, New England Biolabs) and the small RNA fraction sequenced (NextSeq 500/550 High Output Kit v2.5 75 Cycles ...
-
bioRxiv - Microbiology 2021Quote: ... 5μL of Nextera XT Index 2 Primers (S5XX) (both from the Nextera XT Index kit, Illumina, USA), 10μL PCR grade water and 25 μL of KAPA© HiFi Hot Start ReadyMix (Roche ...
-
bioRxiv - Microbiology 2019Quote: ... for 2 hours at 25 °C and reverse transcription was performed with Reverse Transcription Primer (Illumina sequence) using SuperScript IV Reverse Transcriptase (ThermoFisher ...
-
bioRxiv - Microbiology 2020Quote: ... Amplicons generated using the modified primers were barcoded using Nextera XT index kit (Illumina, San Diego, CA). An Illumina MiSeq instrument was used for sequencing 250 base pairs in both directions ...
-
bioRxiv - Microbiology 2022Quote: ... and samples were labelled with index primers using Nextera XT Index kit (Illumina, San Diego, CA, USA). Paired end sequencing was performed with the Illumina MiSeq system ...