Labshake search
Citations for Illumina :
551 - 600 of 899 citations for Goat Anti Mouse IgG Fc Alkaline Phosphatase since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genomics 2020Quote: ... 25 μL TD buffer and 2.5 μL TDE1 enzyme from Nextera DNA Library Prep Kit (Illumina, cat. no. FC-121-1030)) ...
-
bioRxiv - Microbiology 2019Quote: ... Illumina recommended denaturation and loading recommendations which included a 1% PhiX spike in (PhiX Control v3 Illumina Catalogue FC-110-3001). Whole genome sequencing data has been deposited in the Sequence Read Archive under PRJNA529870.
-
bioRxiv - Genetics 2019Quote: ... MS-103-2003) at a concentration of 15 nM with an addition of 25% Phix Control v3 (Illumina, FC-11-2003).
-
bioRxiv - Systems Biology 2019Quote: ... 2ng of the amplified cDNA was converted into sequencing library with the Nextera XT DNA Library kit (Illumina, FC-131-1024), according to supplied protocol ...
-
bioRxiv - Neuroscience 2019Quote: ... The diluted libraries were then loaded onto a reagent cartridge and forwarded to a sequencing run on the Illumina NextSeq 500 system (RRID: SCR_014983) by using a NextSeq 500/550 V2.5 kit (Illumina, USA, #FC-404) in accordance with manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2020Quote: ... TN5 tagmentation and library amplification realized 3’end fragments by Nextera XT DNA Sample Preparation Kit (Illumina, Cat#FC-131-1024) according to the manufacturer’s instructions while P5_TSO and Nextera_N7xx took the place of the custom primers ...
-
bioRxiv - Physiology 2021Quote: ... cDNA was subsequently tagmented and amplified for 12 cycles by using a Nextera XT DNA Library Preparation Kit (Illumina FC-131). Sequencing libraries were analyzed with Qubit and Agilent Bioanalyzer ...
-
bioRxiv - Cancer Biology 2020Quote: ... Samples were cleaned using Sample Purification Beads from the TruSeq Methyl Capture EPIC LT Library Prep Kit (Illumina, #FC-151-1002) according to the manufacturer’s instructions with modifications ...
-
bioRxiv - Neuroscience 2022Quote: ... Nuclei were pelleted (500xg, 10 min, 4 °C) and tagmented with the Nextera DNA Library Prep Kit (Illumina, FC-121-1030) for 1 h at 37 °C ...
-
bioRxiv - Microbiology 2020Quote: ... ChIP-seq libraries were sequenced on the Illumina NextSeq 500 system with a 20% phiX spike-in (Illumina, FC-110-3001) to generate 75 bp single-end reads (NextSeq 500/550 High Output v2 kit) ...
-
bioRxiv - Immunology 2020Quote: ... The second round PCR (8 cycles, 70°C annealing temperature) was performed using Nextera XT index primers (Illumina, FC-131-2001) which introduce 8 base pair indices on the 5’ and 3’ termini of the amplicon for data demultiplexing of each sample screened ...
-
bioRxiv - Neuroscience 2022Quote: ... Amplified cDNA (0.125-0.375 ng) was used for generating sequencing libraries with the Illumina Nextera XT DNA kit (Illumina, FC-131-1096). All libraries were sequenced as paired-end 75 using the Illumina HiSeq4000 system.
-
bioRxiv - Synthetic Biology 2019Quote: ... The RNAseq data was generated on an Illumina NextSeq500 75 SE high-output flow-cell (Illumina, cat no. FC-404-2005). The run yielded approximately 550 million reads ...
-
bioRxiv - Evolutionary Biology 2019Quote: We assessed input gDNA quantity using Qubit and normalised the samples to 20ng/ul as described in TruSeq®DNA PCR-Free Library Prep Reference Guide (#FC-121-3001, Illumina) prior fragmentation to 350bp with Covaris S2 ...
-
bioRxiv - Molecular Biology 2020Quote: We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the above elute as template ...
-
bioRxiv - Physiology 2020Quote: ... Samples were sequenced Single-reads 76 bases using the NextSeq 500 High Output Kit 75-cycles (Illumina, Cat# FC-404-1005), and primary data analysis was performed with the Illumina RTA version 2.4.11 and Basecalling Version bcl2fastq-2.20.0.422.
-
bioRxiv - Microbiology 2020Quote: ... aeruginosa (Pae5 and Pae1505) genomic DNA sequencing libraries were prepared using Nextera DNA library prep kit (Illumina, Cat # FC-121-1031) and utilizing the Nextera DNA Sample Preparation Index Kit (Illumina ...
-
bioRxiv - Cell Biology 2020Quote: ... and DNA libraries for sequencing were constructed using Nextera XT DNA Library Prep kit (FC-131-1024, Illumina, San Diego, CA). The 24 prepared libraries were pooled and submitted to Michigan State University Genomics Facility ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were prepared based on a 20X scaled-down Nextera XT DNA Library Prep Kit (Illumina, Cat. No. FC-131-1024) protocol (35 ...
-
bioRxiv - Genomics 2021Quote: ... and 8.8 µl of paired i7 and i5 Nextera XT Index Kit V2 indexing primers (Illumina, Cat. No. FC-131-2001) were added to each Tagmentation reaction ...
-
bioRxiv - Neuroscience 2021Quote: ... Tagmentation by Tn5 was performed using reagents from the Nextera DNA Sample Preparation Kit (FC-121-1030, Illumina; San Diego, CA) as previously described [5] ...
-
bioRxiv - Genomics 2020Quote: ... and sequenced on an Illumina NextSeq 500 (NextSeq control software v2.0.2/Real Time Analysis v2.4.11) using a 150-cycle NextSeq 500/550 High Output Reagent Kit v2 (Illumina, FC-404-2002) in standalone mode as follows ...
-
bioRxiv - Immunology 2021Quote: ... single reads and 7 bases index read on an Illumina HiSeq2000 instrument using the TruSeq SBS Kit HS-v3 (50-cycle, FC-401-3002, Illumina Inc). RNA seq data in FASTQ form from each sample were first quality assessed using fastQC ...
-
bioRxiv - Genomics 2020Quote: ... Nuclei were resuspended in 50 ul of the transposase reaction buffer (Nextera DNA library prep kit (Illumina cat. FC-121- 1030) and 22.5 ul nuclease-free water ...
-
bioRxiv - Genomics 2019Quote: ... paired-end mode with R1 67 and R2 8) at 1.8 pM loading concentration with 2.5% PhiX spike-in (PhiX Control V3 [Illumina FC-110-3001]) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2022Quote: ... Tagmentation by Tn5 was performed using reagents from the Nextera DNA Sample Preparation Kit (FC-121-1030, Illumina; San Diego, CA) as previously described (Buenrostro et al. ...
-
bioRxiv - Cancer Biology 2022Quote: ... multiplex sample pool (1.5pM including PhiX 1.5%) was loaded in NextSeq 500/550 High Output v2 Kit (75 cycles) cartridge (Illumina; FC-404-1005) and loaded on NextSeq 500 System Machine (Illumina ...
-
bioRxiv - Developmental Biology 2023Quote: ... 4-10 ng of the full-length cDNA was used as input for preparing Nextera XT (Illumina, cat. # FC-131-1024) libraries following the manufacturer’s recommendations ...
-
bioRxiv - Molecular Biology 2023Quote: ... 2.5 μL Tn5 transposase and 22.5 μL ddH2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... 4 nM library pools were diluted and denatured to 1.3 pM and dual index sequenced on an Illumina Miniseq using a Miniseq Mid Output 300 cycle Reagent kit (FC-420-1004, Illumina, USA). High quality Miniseq runs produced > 2.0Gb ...
-
bioRxiv - Plant Biology 2023Quote: ... libraries were prepared from 2 µg of total RNA using the TruSeq RNA Sample Prep Kit (Illumina, Cat # FC- 122-1001) and sequenced on the HiSeq 4000 to produce at least 18 million 50 bp single-end reads.
-
bioRxiv - Biophysics 2023Quote: ... 100-120 μl pooled-denatured 20 pM library and 10-20 μl 20 pM PhiX control library (Illumina, FC-110-3001) to provide a reasonable spot density in general ...
-
bioRxiv - Biophysics 2023Quote: ... We performed 8 additional cycles of PCR with Nextera 24-Index kit for indexing before sample pooling (Illumina, FC-121-1011), for which we used 7.5 μl of the elute as template ...
-
bioRxiv - Genomics 2023Quote: ... Samples were then loaded onto the Illumina NextSeq500 Instrument using a Mid-output 300 cycle kit (Illumina Catalogue FC-404-2003) or the MinION flow cell ONT instrument (R9.4.1) ...
-
bioRxiv - Microbiology 2023Quote: The Acinetobacter isolates libraries were prepared with the Nextera XT DNA Library preparation kit from Illumina (Cat. No.: FC-131-1096) and were sequenced with the NextSeq 550 instrument (Illumina ...
-
bioRxiv - Neuroscience 2023Quote: ... The denatured library with a final loading concentration of 400 pM in a pool was loaded on the S4 FC using Illumina SBS kits (Illumina, 20012866) with the following setting on the NovaSeq 6000 ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Cancer Biology 2024Quote: ... which was eluted and processed as described in the SPLiT-seq protocol using the Nextera XT kit (Illumina #FC-131-1024) to generate the final RNA derived cDNA SPLiT-seq libraries [9] ...
-
bioRxiv - Developmental Biology 2020Quote: Libraries were sequenced on an Illumina HiSeq X™ using HiSeq X™ Five Reagent Kit v2(Illumina, Cat# FC-502-2021).
-
bioRxiv - Synthetic Biology 2022Quote: ... Indexes were added to the amplified DNA using i5 and i7 primers from the Nextera XT Index Kit (Illumina # FC-131-1002). Indexed samples were loaded into a MiSeq Reagent Kit v3 600-cycle (Illumina # MS-102-3003 ...
-
bioRxiv - Genomics 2020Quote: ... Samples were prepared for sequencing using 1 ug of genomic DNA following the TruSeq PCR free kit protocol (Illumina, FC-121-3001). Resulting libraries were quality checked on an Agilent DNA 1000 bioanalyzer (Agilent Technologies ...
-
bioRxiv - Bioengineering 2020Quote: ... cDNA libraries were single-end sequenced in 76 cycles using a NextSeq 500 Kit v2 (FC-404-2005, Illumina, San-Diego, CA). High-throughput sequencing was performed using NextSeq500 sequencing system (Illumina ...
-
bioRxiv - Microbiology 2019Quote: ... Libraries were sequenced using a 150 bp paired-end NextSeq High Output V2 reagent kit (Illumina, FC-404-2004, San Diego, CA). Illumina short reads were assembled into contigs in two steps ...
-
bioRxiv - Molecular Biology 2019Quote: ... 2.5 µL Tn5 transposase and 22.5 µL nuclease-free H2O) using reagents from the Nextera DNA library Preparation Kit (Illumina #FC-121-103). Samples were then incubated at 37°C for 30min ...
-
bioRxiv - Genomics 2020Quote: ... 2000 and underwent a 50 cycle single read sequence run with TruSeq SBS Kit v3-HS reagents (Illumina, Cat. FC-401-3002). The raw sequence reads were aligned to the reference genome using STAR (version 2.7.3a) ...
-
bioRxiv - Cancer Biology 2021Quote: ... A total of 140 pg of the amplified cDNA was fragmented using Nextera XT DNA sample preparation kit (Illumina FC-131-1096) and amplified with Nextera XT indexes (Illumina FC-131-1001) ...
-
bioRxiv - Cancer Biology 2022Quote: ... an equal combination of additional PCR products containing two inverse barcodes (GACTCAGTGTCAGACTGAGTGTCTGACTGT and CTGAGTCACAGTCTGACTCACAGACTGACA) plus the PhiX Control V3 (Cat. FC-110-3001, Illumina, CA, USA) were spiked in to balance the nucleotide distribution within the library ...
-
bioRxiv - Cancer Biology 2020Quote: ... Drop-seq denatured libraries were loaded at 1.3pM final concentration and were spiked in with 10% of 1.8pM PhiX Control v3 (Illumina Cat# FC-110-3001). Sequencing specifications were as follows ...
-
bioRxiv - Genomics 2019Quote: ... Tagmentation of cDNA was performed and sequencing libraries were prepared using the Nextera XT DNA sample preparation kit (Illumina, FC-131-1096) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2019Quote: ... Second, the pellet was resuspended in the transposase reaction mix (25 μl 2× TD buffer, 2.5 μl transposase (Illumina, FC-121-1030) and 22.5 μl nuclease-free water) ...