Labshake search
Citations for Illumina :
551 - 600 of 2218 citations for 8' Bromo 2' 3' dihydro 1'h spiro cyclopropane 1 4' isoquinoline since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2020Quote: ... 1 ng of DNA was used to create Nextera XT libraries according to manufacturer’s instructions (Illumina).
-
bioRxiv - Immunology 2021Quote: ... Add 30 μl PCR master mix (2.5 μl Illumina dual indexes primer 1, 2.5 μl Illumina dual index primer 2 ...
-
bioRxiv - Genomics 2021Quote: ... About 320 million paired-end raw reads were generated for AGENOME-ZPMS-HV2a-1 by Illumina sequencing.
-
bioRxiv - Immunology 2023Quote: ... 10% v/v dimethylformamide) containing 1 μl Tagment DNA Enzyme (Nextera DNA Sample Prep Kit (Illumina)) ...
-
bioRxiv - Molecular Biology 2023Quote: ... 1 µl of the forward and reverse fusion primers (10 µM; including Illumina sequencing adapters; SI6), 2 µl of the cleaned-up PCR product ...
-
bioRxiv - Cancer Biology 2024Quote: ... 1 μg of RNA was used for library preparation with Truseq Stranded Total RNAseq kit (Illumina) with rRNA removal and sequenced on Illumina Novaseq 6000 (150 bp paired-end mode ...
-
bioRxiv - Genomics 2024Quote: ... samples were incubated in incorporation mix (MiSeq Nano kit v2 reagent 1) (Illumina MS-103-1003) for 5 minutes at 60 °C on a flat-top thermal cycler ...
-
bioRxiv - Developmental Biology 2024Quote: ... 1 µg of DNAse-treated RNA was treated with RiboZero Gold (Human/Mouse/Rat) kit (Illumina) to remove rRNAs ...
-
bioRxiv - Microbiology 2023Quote: ... and sequenced at Novogene on 1 HiSeq PE 150 lane (6 bp, i7 single index, Illumina). The output of the lane was 375 million reads.
-
bioRxiv - Plant Biology 2024Quote: ... 1 μg of total RNA was processed with the TruSeq Stranded Total RNA LT Kit (Illumina) as follows ...
-
bioRxiv - Molecular Biology 2022Quote: ... 6 pM of DNA library spiked with 1% PhiX viral DNA was clustered on cBot (Illumina) and then sequenced on a HiScanSQ module (Illumina) ...
-
bioRxiv - Genetics 2023Quote: ... and the libraries were subjected to 1 × 7 bp high-throughput sequencing by NextSeq 500 (Illumina).
-
bioRxiv - Bioengineering 2023Quote: ... and samples were sequenced as 1 × 86 bp single-end reads on the NextSeq500 (Illumina, US), yielding on average 42 M reads per sample ...
-
bioRxiv - Microbiology 2024Quote: ... 1 µg of total RNA was processed by Ribo-Zero Magnetic Kit (Bacteria) (#MRZB12424, Illumina, USA). Resulting rRNA-depleted mRNA was phosphorylated by T4 polynucleotide kinase (#M0201 ...
-
bioRxiv - Molecular Biology 2024Quote: ... Single read 1 x 50 bp sequencing of these libraries was performed in HiSeq-2500 (Illumina).
-
bioRxiv - Molecular Biology 2024Quote: ... libraries were prepared using Index Primer Set 1 (NEBNext Multiplex Oligos for Illumina, E7335L, Lot 10172541), Ultra II FS DNA Library Prep Kit for Illumina (E7805L ...
-
bioRxiv - Microbiology 2024Quote: ... A library was prepared independently with 1 μg of total RNA for each sample by Illumina TruSeq Stranded mRNA Sample Prep Kit (Illumina ...
-
bioRxiv - Developmental Biology 2024Quote: ... Libraries were then prepared from 1 ng cDNA using the Nextera XT DNA Library Kit (Illumina). Libraries were sequenced (> 2.107 reads/library ...
-
bioRxiv - Microbiology 2021Quote: ... and Bakt_805R (GACTACGVGGGTATCTAATCC)38 PCR primer pair with an individual 8 bp barcode adapter (based on the NEB Multiplex Oligos for Illumina, New England Biolabs) attached to the forward primer and the reverse primer ...
-
bioRxiv - Microbiology 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Evolutionary Biology 2023Quote: ... and were then sent to the Swedish National Genomics Infrastructure’s SNP & SEQ platform in Uppsala for Illumina HiSeq 2500 sequencing (8 lanes; 126 bp Paired-End sequencing; Illumina, San Diego, CA, USA).
-
bioRxiv - Neuroscience 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Microbiology 2022Quote: ... with up to 100 ng DNA input following the manufacturer’s protocol using internal single-index 8 bp barcodes with TruSeq®adapters (Illumina, San Diego, CA) or the Nextera®DNA Flex Library Prep Kit (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... The tagmentation and library preparation was performed with the Nextera DNA Library Preparation Kit with 8 cycles of PCR amplification (Illumina #FC-121-1030).
-
bioRxiv - Physiology 2023Quote: ... RNA samples with RQNs ranging from 8 to 10 were used for RNA library preparation with the TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Microbiology 2024Quote: ... Purified libraries were sequenced on Illumina MiSeq platform (reagent kits: v2 300-cycles, paired- end mode) at 8 pM loading concentration with 25% PhiX spike-in (Illumina FC-110-3001). Custom sequencing primers were spiked into reagent cartridge (well 12 ...
-
bioRxiv - Cancer Biology 2024Quote: ... The two final libraries were diluted to 2nM and pooled for paired-end sequencing 51+8+0+71 cycles in one NovaSeq 6000 S4 lane (Illumina, San Diego, CA) at the SNP&SEQ Technology Platform (Uppsala ...
-
bioRxiv - Microbiology 2020Quote: ... Samples were sequenced using the MiSeq 2×250 bp and HiSeq 2×150 bp paired-end read technology (Illumina, San Diego, CA, USA) as previously described [78] ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced across three lanes of a HiSeq or pooled for sequencing on a NovaSeq S1 using 2×75 (HiSeq) or 2×101 (NovaSeq) read lengths (Illumina, San Diego, CA). Variant calling and neoantigen prediction were performed as described previously (22,23).
-
bioRxiv - Evolutionary Biology 2020Quote: ... The blunt-ended double stranded cDNA was 3’adenylated and Illumina single indexed adapters (Illumina) were ligated ...
-
bioRxiv - Microbiology 2020Quote: ... 3’ adapter sequences from the Illumina TruSeq Small RNA Library Preparation Kit (Illumina, RS-200) were ligated onto the dsRNA species by mixing together 1 μl of adapter with 1 μg dsRNA in a 6 μl reaction and heated at 70°C for 2 minutes ...
-
bioRxiv - Genomics 2022Quote: ... An “A” base was then added to the 3’ end and the adaptor from Illumina was ligated only to one end of the resultant dsDNA as the other end contained a 5’ overhang introduced by the N9 primer ...
-
bioRxiv - Neuroscience 2021Quote: ... followed by A-tailing and ligation at the 3’ ends with paired-end adaptors (Illumina) with a single “T” base overhang ...
-
bioRxiv - Cancer Biology 2021Quote: Four 3’ PCR primers were used each containing a unique index (underlined) recognized by Illumina:
-
bioRxiv - Neuroscience 2023Quote: ... using the combination of primer Ad1_noMX (5’ AATGATACGGCGACCACCGAGATCTACACTCGTCGGCAGCGTCAGATGTG 3’) and the Nextera Index Kit (Illumina) primer N701-N706 ...
-
bioRxiv - Biochemistry 2023Quote: ... mRNA libraries were prepared using the QuantSeq 3’ mRNA-Seq Library Prep Kit FWD (Illumina). Quality of mRNA libraries was determined using Agilent Tape Station and mRNA was sequenced at 75 bp single read sequencing using NextSeq 500 (Illumina).
-
bioRxiv - Synthetic Biology 2022Quote: ... adding barcodes to identify the sample (primers P3-P15 in Supplementary Table 3, containing Illumina Nextera tagmentation adapters and ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scATAC-seq library was sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (75 Cycles ...
-
bioRxiv - Developmental Biology 2021Quote: ... 4 nM 10X scRNA-seq libraries were sequenced on a NextSeq500 platform (Illumina) using NextSeq 500/550 High Output Kit v2.5 (150 Cycles ...
-
bioRxiv - Biophysics 2022Quote: ... The sequencing (Step 4) was performed using a Hi-Seq sequencer (Illumina, US) and the data was then filtered using the framing sequence ACAC with a quality score larger then 20 and analyzed (Step 5 ...
-
bioRxiv - Cell Biology 2023Quote: ... 4 ATAC-seq libraries were sequenced per lane in HiSeq 2500 System (Illumina) to generate paired-end 50-bp reads ...
-
bioRxiv - Microbiology 2024Quote: ... DNA from the V3-4 region was amplified using a primer set (Illumina, San Diego ...
-
bioRxiv - Genomics 2022Quote: ... SW-8046-2) from libraries prepared using the Nextera XT DNA kit (Illumina, Inc, San Diego, CA, and sequenced on Illumina HiSeq4000 (2×150 bp). WGS data was obtained from six C ...
-
bioRxiv - Cancer Biology 2022Quote: ... generating 2 × 75 base read pairs or on a NovaSeq 6000 generating 2 × 150 base read pairs using standard settings (Illumina, San Diego, CA, USA). BCL output from the sequencing platform was converted to FASTQ using Illumina’s bcl2fastq tool (versions 2.17 to 2.20 ...
-
bioRxiv - Genomics 2024Quote: SARS-CoV-2 genome sequencing was performed on samples that were SARS-CoV-2 RNA-positive using the COVIDSeq Test (Illumina, San Diego, CA, USA). Libraries were sequenced on the Illumina NextSeq2000 instrument using 2×109 paired end reads ...
-
bioRxiv - Genomics 2020Quote: ... and 8 to 11 kb were generated using the gel selection-based protocol of the Nextera mate pair kit (Illumina, San Diego, CA, USA) and a 0.6% agarose gel in accordance with the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... with up to 100 ng DNA input following the manufacturers protocol using internal dual-index 8 bp barcodes with Nextera® adapters (Illumina, San Diego, CA). All libraries were quantified with TapeStation®(Agilent Technologies ...
-
bioRxiv - Microbiology 2022Quote: ... All samples showed a high RNA quality (RNQ>8) and were sequenced using an Illumina® HiSeq 3000 sequencer (Illumina, San Diego, CA, USA). Reads were mapped to the Sscrofa11.1 assembly of the Swine Genome Sequencing Consortium (SGSC ...
-
bioRxiv - Genomics 2024Quote: ... RNA samples with a RIN value ≥ 8 were used to prepare sequencing libraries with the TruSeq Stranded mRNA Kit (Illumina, San Diego, CA, USA) following the manufacturer’s protocol.
-
bioRxiv - Evolutionary Biology 2024Quote: ... RNA (n = 6) and DNA (n = 8) metage-nomic libraries were prepared and run on an Illumina HiSeq 2500 platform (Illumina, San Diego, CA, USA) at Génome Québec in a paired-end 125 bp configuration ...