Labshake search
Citations for Illumina :
551 - 600 of 2264 citations for 1R 2S 6R 7S 4 4 DIMETHYL 3 5 DIOXA 8 AZATRICYCLO 5.2.1.0 2 6 DECAN 9 ONE since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Systems Biology 2021Quote: ... Libraries of extracted RNAs whose A260/A280 >1.8 and RIN >8 were built using the Illumina TruSeqTM RNA sample preparation kit (RS-122-2001, Illumina) and sequenced by an illumina HiSeq 2000 system with paired-end 100-bp reads ...
-
bioRxiv - Genomics 2023Quote: ... 8 μl of modified DNA was subjected to methylation analysis on the Illumina Infinium MethylationEPIC BeadChip (Illumina, CA, USA) at UCL Genomics according to the manufacturer’s standard protocol.
-
bioRxiv - Neuroscience 2023Quote: ... 8 µL was amplified and hybridized on the Infinium MehtylationEPIC BeadChip (EPIC array; Illumina, Inc., San Diego, CA, U.S.A.). All samples were randomized in a balanced manner for sex and Braak stage ...
-
bioRxiv - Immunology 2022Quote: ... 5,000-50.000 cells per experiment were centrifuged 5 minutes at 8°C, and resuspended in 25 µl transposase mixture (12.5 µl Tagmentation DNA buffer, 1 µl Tn5 transposase (Illumina), 10.75 µl nuclease-free water ...
-
bioRxiv - Genetics 2024Quote: ... RNA samples with RIN > 8 were used for the library preparation using TruSeq stranded total RNA kit (Illumina, 15035748). Yield of final prepared libraries were quantified in Qubit 4.0 fluorometer (Thermofisher ...
-
bioRxiv - Genetics 2024Quote: ... 100 ng of DNase treated total RNA (RIN > 8) was processed with the TruSeq Stranded mRNA Prep Kit (Illumina) including poly(A ...
-
bioRxiv - Microbiology 2022Quote: ... 5’GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGACTACHVGGGTATCTAAT CC3’) and ITS region amplification (primer 86F: 5’ TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGGTGAATCATCGAATCTTTGAA3’; 4R: 5’ GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGTCCTCCGCTTATTGATATGC3’) and sequencing on the MiniSeq platform (Illumina®) to generate paired-end (PE ...
-
bioRxiv - Genetics 2024Quote: ... 5 μL index primer N7xx and 5 μL index primer S5xx from Nextera XT V2 Index kit (Illumina, FC-131-2001) were used for the total volume of 50 μL ...
-
bioRxiv - Physiology 2024Quote: ... sequencing was performed on a NextSeq instrument (2×75bp 2×10) according to the manufacturer instructions (Illumina Inc.) Reads were trimmed and ribosomal RNA reads were removed ...
-
bioRxiv - Molecular Biology 2020Quote: ... was performed using the SureCell WTA 3’ library prep kit (Illumina, 20014279) according to manufacturer’s instructions with minor modifications ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... using 300-cycle kit (v.3, Illumina, Inc., San Diego, CA, USA) to obtain 150 bp paired-end reads.
-
bioRxiv - Neuroscience 2021Quote: ... 3′ gene expression libraries were dual-index sequenced using NextSeq 150bp (Illumina) flow cells by the Duke Center for Genomic and Computational Biology Core Facility.
-
bioRxiv - Cell Biology 2021Quote: ... The final constructed 3’- biased single cell libraries were sequenced by Illumina Nextseq500 machine ...
-
bioRxiv - Genomics 2021Quote: ... GSA version 3 with direct-to-consumer booster by Illumina (Fig. 1). This Customized chip is the intersection of commonly used chips ...
-
bioRxiv - Immunology 2022Quote: ... and mixed with 3 μl of Illumina TDE1 Tn5 transposase (Illumina, 15027916). Transposition was performed by incubating the prepared reactions on a C1000 Touch thermal cycler with 96–Deep Well Reaction Module (Bio-Rad ...
-
bioRxiv - Microbiology 2023Quote: ... or matched the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Microbiology 2023Quote: ... or matching the PhiX version 3 positive control (Illumina; FC-110-3001). After filtering ...
-
bioRxiv - Genetics 2023Quote: ... The final constructed 3’-biased single cell libraries were sequenced by Illumina Novaseq6000 machine ...
-
bioRxiv - Developmental Biology 2023Quote: ... Libraries 1-3 (wild type) were sequenced on a NovaSeq 6000 (Illumina) and the mutant library was sequenced on a NextSeq 500 (Illumina) ...
-
bioRxiv - Developmental Biology 2023Quote: ... distributed over 3 lanes of a HiSeq 2500 with v4 chemistry (Illumina). Sequencing was performed by the Next Generation Sequencing Facility at Vienna BioCenter Core Facilities (VBCF) ...
-
bioRxiv - Immunology 2024Quote: ... and the SureCellTM WTA 3’ Library Prep Kit (Illumina, San Diego, CA). Magnetically enriched NK cells from malaria-naïve subjects were treated with cytokines IL-15 ...
-
bioRxiv - Plant Biology 2024Quote: ... The 3’mRNA-sequencing was performed in a NovaSeq X (Illumina Platform) by Seqplexing (Paterna ...
-
bioRxiv - Plant Biology 2021Quote: One microgram of total RNA was used to generate RNA-seq libraries using TruSeq Stranded mRNA Library Prep Kit (Illumina Inc.) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2022Quote: ... a total of 2.58 × 108 assembled paired-end reads was obtained as two 33 Gb FastQ files (one file per Illumina-sequence lane). The sequence quality was evaluated by means of the FastQc software (Andrews ...
-
bioRxiv - Developmental Biology 2021Quote: ... parental DNA was extracted from one individual male and female from tail-fin clip and sequencing library were synthesized with Nextera XT Kit (Illumina, USA) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... The short-read paired-end libraries were sequenced in two independent lanes and the mate-pair library in one lane using the Illumina HiSeq4000 platform (Illumina, USA). The library’s construction and sequencing were performed by Hokkaido System Science Co ...
-
bioRxiv - Genomics 2021Quote: Microarray-derived SNP genotypes were available for 30,499 BSW cattle typed on seven low-density (20k-150k) and one high-density chip (Illumina BovineHD; 777k). Coordinates of the SNP were originally determined according to the ARS-UCD1.2 build ...
-
bioRxiv - Genomics 2020Quote: ... Libraries were then barcoded and pooled into two lanes (eight samples in one and two in another) to generate 100bp paired-end reads on the HiSeq1500 sequencer (Illumina, Inc.).
-
bioRxiv - Neuroscience 2022Quote: ... We pooled up to 12 samples (with different barcodes) in one lane of a flow cell for sequencing (Illumina HiSeq 2500) and used a 150 bp paired-end read configuration ...
-
bioRxiv - Genomics 2022Quote: ... The final Hi-C DNA-Seq library was submitted to Novogene (www.en.novogene.com) for one lane of PE150 Illumina HiSeq X-Ten (Illumina, San Diego, CA, USA) sequencing.
-
bioRxiv - Genomics 2022Quote: ... These products were then used for index PCR using the SI-PCR Primer from the 10X kit for the i5 and one of the small RNA TrueSeq index primers for the i7 (Illumina #15004197).
-
bioRxiv - Evolutionary Biology 2023Quote: ... We then sequenced the entire pooled library on one lane of a NovaSeq6000 SP flowcell (2x150bp; Illumina, Inc. San Diego, CA) at the University of Iowa Institute of Human Genetics.
-
bioRxiv - Genomics 2023Quote: ... Libraries were pooled and sequenced (2x150nt) on one lane of a S1 flowcell on the NovaSeq 6000 (Illumina, San Diego, CA). FastQ files were generated and demultiplexed with the bcl2fastq v2.20 Conversion Software (Illumina).
-
bioRxiv - Bioengineering 2024Quote: The final 10X single cell GEX library and CSP library were sequenced on one lane in an Illumina NovaSeq X Plus 10B Flowcell (Illumina, CA) as paired reads with 28 cycles for read 1 ...
-
bioRxiv - Cell Biology 2024Quote: ... Quality and concentration of all libraries was determined by capillary electrophoresis and sequenced (one lane, paired end 150 bp) with Illumina Hiseq 2000 System (Illumina, USA). Each sample gives around 25 million paired end reads (unfiltered) ...
-
bioRxiv - Systems Biology 2021Quote: ... S4 reagent cartridge (2×100 bp) (Illumina).
-
bioRxiv - Neuroscience 2020Quote: ... ADNI GO/2 participants (Illumina HumanOmniExpress BeadChip), and ADNI3 participants (Illumina Omni 2.5M ...
-
bioRxiv - Microbiology 2020Quote: ... and sequencing (2 × 150 bp, Illumina HiSeq) were performed by Genewiz (South Plainfield ...
-
bioRxiv - Microbiology 2022Quote: ... 2 (Illumina, catalog No. MS-102-2003) by the University of Michigan Microbial Systems Molecular Biology Laboratory as described previously (14) ...
-
bioRxiv - Microbiology 2021Quote: ... 2) merged triplicates for DC3000 + (Illumina only), 3 ...
-
bioRxiv - Microbiology 2022Quote: ... generating 2 × 300bp paired-end reads (Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... and sequenced on 2×150 Miseq (Illumina). Clonal abundances were estimated using a pipeline adapted from 110 ...
-
bioRxiv - Molecular Biology 2023Quote: ... or SMART-Seq™ 2 (Illumina, 20040532), followed by NovaSeq (RIP-seq experiments from Figs ...
-
bioRxiv - Immunology 2023Quote: ... and HiSeq2500 V2 2×150bp (Illumina®) protocols at the “Institut du Cerveau” (ICM ...
-
bioRxiv - Cell Biology 2023Quote: ... and 20 μM reverse P7 primers with 6-bp TruSeq indices that are automatically demultiplexed by Illumina software ...
-
bioRxiv - Developmental Biology 2022Quote: ... All 6 individual libraries were pooled in equal amount and sequenced with the HiSeq 4000 platoform (Illumina). The RNA-seq data are available under the GEO accession no ...
-
bioRxiv - Genetics 2021Quote: ... Individual sequencing barcodes were added to each sample by amplifying the entire 40 μL elution in a 100 μL Q5 NEBNext reaction with 0.5 μM of TruSeq_Universal_Adapter primer and a reverse primer containing a unique 8 bp index (Illumina_Multiplex, Supplementary Table 14) for sample demultiplexing post-sequencing ...
-
bioRxiv - Genomics 2020Quote: ... Other libraries were sequenced on NextSeq 500 (1x 28 / 1×91 cycles plus 8 base index cycle) using the v2 150 cycle High Output kit (Illumina) as per the manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... 150 µl from the 14 pM pool was loaded into each well of an 8-well strip tube and loaded onto a cBot (Illumina) for cluster generation ...
-
bioRxiv - Genetics 2020Quote: ... Libraries that passed quality checks were then subjected to deep sequencing (8-47 × genome coverage; 19 × mean coverage, 11 × median coverage) by HiSeq 2500 (Illumina) or NovaSeq 6000 platforms (Illumina).