Labshake search
Citations for Illumina :
5801 - 5850 of 9497 citations for Rat Vacuole Membrane Protein 1 VMP1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Microbiology 2022Quote: ... Whole genome metagenomic libraries were prepared at LLNL using the Illumina DNA Flex library kit (now called Illumina DNA Prep ...
-
bioRxiv - Microbiology 2022Quote: ... The cleaned pool was sequenced on the Illumina MiSeq using v.2 2_250 base-pair kit (Illumina, Inc). Two PCR controls were also sequenced to test for PCR reagent contamination.
-
bioRxiv - Molecular Biology 2022Quote: ... 1ug of input RNA was subjected to rRNA depletion with the Ribo-Zero Glod Yeast kit (MRZY1324, Illumina) following manufacturer instructions.
-
bioRxiv - Immunology 2022Quote: ... Thermo) and a sequencing library was constructed using the Illumina TruSeq RNA Library Prep for Enrichment kit (Illumina). The sequencing library was enriched for SARS-CoV-2 using the Twist Respiratory Virus Research Panel (Twist) ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA-seq libraries of polyA+-selected samples were prepared using TruSeq Stranded mRNA Library Preparation Kit LT (Illumina). After quality control ...
-
bioRxiv - Immunology 2022Quote: ... libraries were sequenced by Novaseq 6000 platform running Novaseq 6000 S4 Reagent Kit v1.5 300 cycles (Illumina, 20028312) or NovaSeq XP 4-Lane Kit v1.5 (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Enrichment of DNA fragments was performed as described for Illumina TruSeq Nano DNA LT Kit (Illumina, Cat#: 20015964). Sample clean up was performed with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: Library preparation was performed using the tagmentation based Illumina DNAFlex Library Prep kit (Illumina, San Diego, CA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were quantified using the Universal Library Quantification Kit (KAPA) before sequencing on a NextSeq 550 system (Illumina) at the Institute for Research in Immunology and Cancer (IRIC ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA libraries were prepared using the TrueSeq Stranded Total RNA Sample Preparation kit with Ribo-Zero Plus (Illumina) according to the manufacturer’s protocol and sequenced thereafter via paired-end with the NovaSeq 6000 platform (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... A cDNA library was prepared from each RNA sample using the Illumina TruSeq RNA library preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA library of the collected RNA samples was obtained using the TruSeq RNA Library Prep kit from Illumina. Single-end RNA Sequencing was performed on an Illumina HiSeq 2500 Next Generation Sequencing instrument ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced on a NextSeq 550 using a NextSeq 500/550 High Output v2.5 75 cycle kit (Illumina) using custom sequencing primers NP0494-NP0497 ...
-
bioRxiv - Pathology 2024Quote: ... RNA-seq transcriptome libraries were prepared following the NEB Next Ultra RNA Library Prep Kit from Illumina (NEB). NEB Next Poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... All RNA-seq libraries (strand-specific, paired end) were prepared with the TruSeq RNA sample prep kit (Illumina). One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Cell Biology 2023Quote: ... The nuclear pellet was resuspended in transposition reaction mix using the Tagment DNA Enzyme and Buffer Kit (Illumina) as per manufacturer protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Then the libraries were constructed using TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions and sequenced on an Illumina HiSeq X Ten platform and 150 bp paired-end reads were generated ...
-
bioRxiv - Physiology 2024Quote: ... Ribosomal RNA was removed from samples using the Ribo-Zero rRNA removal kit (Illumina, San Diego, CA, USA). Sequencing libraries were prepared using the TruSeq RNA Library Preparation Kit v2 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The libraries were then subjected to paired end sequencing on Illumina Nextseq using Nextseq Mid Output kit (Illumina) with a read length of 150 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg of total RNA samples underwent treatment with the epicenter Ribo-ZeroTM Kit (Illumina, San Diego, USA) to remove rRNA ...
-
bioRxiv - Microbiology 2024Quote: ... DNA for Illumina sequencing was prepared using the Nextera XT DNA library prep kit (Illumina FC-131-1096) with the Nextera XT v2 Index Kit B (Illumina FC-131-2002 ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by ChIP-seq library preparation using ThruPLEX kit (Rubicon, R400427) and sequenced using NextSeq 500 instrument (Illumina) to produce 75-bp single-end reads.
-
bioRxiv - Molecular Biology 2024Quote: ... Library of polyA-containing mRNA (350 bp size) was prepared using TruSeq Stranded mRNA Library Prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Pools were again quantified and sequenced on the Illumina NextSeq500 using NextSeq500/550High Output Kit v2.5 (Illumina, 20024907). The sequencing protocol included 26 cycles for read 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were made using the Illumina Stranded Total RNA Prep with Ribo-Zero Plus kit (Illumina, #20040525). Paired end sequencing was carried out on an Illumina NovaSeq (S4 ...
-
bioRxiv - Microbiology 2024Quote: ... Paired-end reads of 301 bp were generated using the MiSeq Reagent Kit v3 chemistry (600-cycle, Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA libraries were generated from 150 ng of RNA using Illumina’s TruSeq Stranded mRNA Sample Prep Kit (Illumina). Libraries were pooled and single end sequenced (1×75 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 µg of total RNA were depleted for ribosomal RNA using a Ribo-Zero-rRNA removal kit (Illumina), followed by random primed cDNA synthesis ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing libraries were prepared using Illumina TruSeq Stranded Total RNA Library Prep Ribo-Zero Gold kit (Illumina). Transcriptomic analyses on bulk tissues were performed as previously described 52 ...
-
bioRxiv - Physiology 2023Quote: ... RNA-seq libraries were prepared from 500ng of RNA using TruSeq stranded total RNA library preparation kit (Illumina) and barcoded libraries were combined and submitted for sequencing (paired-end 50 cycles on a HiSeq6000 ...
-
bioRxiv - Microbiology 2024Quote: ... and library preparation was performed with the Stranded Total RNA Prep Ligation with Ribo-Zero Plus Kit (Illumina). Libraries were sequenced with 2×50 bp reads on a NextSeq2000 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ligation kit (Reference Guide - PN 1000000124518) and IDT for Illumina RNA UD Indexes Ligation (Illumina, San Diego, USA). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were quantitated with qPCR (NEBNext Library Quant Kit for Illumina, Bio-rad CFX96 Touch Real-Time PCR). Libraries were normalized to 1.5 pM and pooled ...
-
bioRxiv - Cancer Biology 2024Quote: ... Barcoded libraries for each section were generated using the Nextera XT DNA Kit (Illumina Inc., San Diego, CA). After library preparation the barcoded libraries were pooled using bead-based normalization supplied with the Nextera XT kit ...
-
bioRxiv - Microbiology 2024Quote: ... the library was constructed using the TruSeq Nano DNA LT Sample Preparation Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Developmental Biology 2023Quote: ... The small RNA libraries were constructed using the Digital Gene Expression for Small RNA Sample prep kit (Illumina). Sequencing of the small RNA library was performed by Illumina HiSeq Xten ...
-
bioRxiv - Developmental Biology 2024Quote: ... These cells were processed through the Chromium Next GEM Single Cell 3’ Reagent Kits v3.1 (10X Genomics) according to manufacturer’s recommendations and sequenced on Novaseq6000 (Illumina). The data were processed through the CellBender software to decrease contamination by ambient RNA (Fleming et al. ...
-
bioRxiv - Immunology 2024Quote: ... Sequencing libraries were prepared using the Rapid Directional RNA-Seq Kit (NEXTflex) and sequenced on a NextSeq500 (Illumina) generating 75 base long reads (Utrecht DNA Sequencing Facility) ...
-
bioRxiv - Genetics 2024Quote: ... Small RNA libraries were prepared from ∼20–45 nt total RNAs using Small RNA Library Preparation kit (Illumina) and analyzed by Illumina HiSeq 2500 platform.
-
bioRxiv - Evolutionary Biology 2024Quote: ... the libraries were prepared using a DNA Prep Tagmentation kit and IDT (UD) indexes (Illumina, Hayward, CA, USA). The libraries were sequenced at the NGI on an Illumina MiniSeq platform with a 2x150 bp paired-end setup using a MiniSeq Mid Output kit ...
-
bioRxiv - Genomics 2023Quote: ... DNA libraries were constructed using the NGS Nextera FLEX DNA library preparation kit (Illumina Inc., San Diego, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Libraries were individually created for each clone following a modified Nextera XT DNA Library Prep Kit protocol (Illumina). Tagmentation and amplification was carried out at one-quarter volume with Nextera XT Index Kit v2 adapters ...
-
bioRxiv - Microbiology 2024Quote: ... A paired-end library was constructed using a TruSeq DNA PCR-Free Library Prep kit (Illumina, CA, USA) and size-selected on an agarose gel using a Zymoclean Large Fragment DNA Recovery Kit (Zymo Research ...
-
bioRxiv - Immunology 2024Quote: ... The PCR products were then tagged using the Nextera XT Index Kit v2 Sets A to B (Illumina), with the amplicon concentrations normalized to 200 ng/µl via the Qubit high sensitivity dsDNA assay before pooling ...
-
bioRxiv - Immunology 2024Quote: ... and library preparation was performed using a TruSeq-stranded mRNA sample prep kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Genomics 2024Quote: ... 1.3 μg of total RNA was prepared for sequencing using the Illumina TruSeq mRNA Stranded Library Kit (Illumina) following the manufacturer’s instructions.
-
bioRxiv - Immunology 2024Quote: ... Amplicons were cleaned using AMPure beads and input into the Illumina DNA Prep Kit (Illumina, San Diego, CA) according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2024Quote: ... RNA sequencing libraries were prepared using the Illumina Stranded mRNA prep ligation kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Immunology 2024Quote: ... RNA-seq libraries were prepared by using 200 ng total RNA with TruSeq RNA sample prep kit (Illumina). Oligo(dT)-enriched mRNAs were fragmented randomly with fragmentation buffer ...