Labshake search
Citations for Illumina :
5701 - 5750 of 9151 citations for Rat Endoplasmin HSP90b1 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were sequenced on an Illumina NextSeq 500 instrument with a High Output v2.5 reagent kit (Illumina # 20024906).
-
bioRxiv - Cancer Biology 2023Quote: ... in single-end mode using the NextSeq 1000/2000 P2 Reagents (100 Cycles) kit (Illumina, cat. no. 20046811). See Supplementary Table 9 for a summary of sequencing statistics.
-
bioRxiv - Cancer Biology 2023Quote: ... amplicons were pooled and sequenced on the NextSeq 550 platform (Nextseq 500/550 Mid Output Kit v2.5, Illumina, for primers see Supplementary Data Set 1).
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were prepared using the QuantSeq 3′mRNA-Seq Library Prep Kit-FWD by Illumina (Lexogen, Vienna, Austria), using 500 ng of total RNA ...
-
bioRxiv - Systems Biology 2023Quote: ... The sequencing library was constructed using the Nextera XT DNA Library LT kit (Illumina, San Diego, CA, USA), according to the manufacturer’s protocols ...
-
bioRxiv - Microbiology 2023Quote: ... Thereafter cDNA libraries were made using an Illumina TruSeq Stranded total Library Prep Kit (Illumina, San Diego, US) in combination with TruSeq RNA UD Indexes (Illumina ...
-
bioRxiv - Genomics 2023Quote: ... Pooled male and pooled female libraries were constructed using a Truseq nano kit (Illumina, ref. FC-121-4001) following the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... The cDNA sequencing libraries were prepared using a TruSeq Stranded mRNA Library Prep Kit (Illumina, San Diego, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Physiology 2023Quote: ... RNA-seq libraries were prepared from 500ng of RNA using TruSeq stranded total RNA library preparation kit (Illumina) and barcoded libraries were combined and submitted for sequencing (paired-end 50 cycles on a HiSeq6000 ...
-
bioRxiv - Plant Biology 2023Quote: Transcriptome libraries were prepared following the instructions of TruSeqTM RNA sample preparation Kit (Illumina, San Diego, CA, USA). Briefly ...
-
bioRxiv - Cell Biology 2023Quote: ... Libraries were prepared for sequencing using a TruSeq Stranded mRNA sample prep kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... A cDNA library was prepared from each RNA sample using the Illumina TruSeq RNA library preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... prior to generating individual indexed libraries each from 1 μg RNA using the Stranded mRNA Prep kit (Illumina), as recommended ...
-
bioRxiv - Genetics 2024Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Microbiology 2024Quote: ... All RNA-seq libraries (strand-specific, paired end) were prepared with the TruSeq RNA sample prep kit (Illumina). One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... The protocol for library preparation with the Illumina TruSeq Stranded mRNA kit (Illumina Cat no: 20020595, Illumina, USA) was adapted for automation on the Agilent NGS Bravo workstation (Agilent Technologies ...
-
bioRxiv - Plant Biology 2024Quote: ... The protocol for library preparation with the Illumina TruSeq Stranded mRNA kit (Illumina Cat no: 20020595, Illumina, USA) was adapted for automation on the Agilent NGS Bravo workstation (Agilent Technologies ...
-
bioRxiv - Genetics 2024Quote: ... Libraries were sequenced on Illumina NextSeq 500 sequencer (75-bp paired-end reads, high output kit Illumina #20022907) at the CRISPR core ...
-
bioRxiv - Genomics 2024Quote: ... Sequencing libraries were generated from the cDNA using the Nextera XT DNA Library Preparation Kit (Illumina, CA, USA) and sequencing was conducted on an Illumina NovaSeq 6000 system with a 2 × 100 bp read length.
-
bioRxiv - Immunology 2024Quote: ... A dual indexed cDNA library was then prepared with use of Nextera XT DNA Library Prep Kit (Illumina). Each library was quantified ...
-
bioRxiv - Genomics 2024Quote: ... Each sWGA library was prepared using the two pooled amplification products and a Nextera XT DNA kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Genomics 2024Quote: ... each sWGA library was prepared using the two pooled amplification products and a Nextera XT DNA kit (Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Microbiology 2024Quote: ... Qualified RNA was subjected to cDNA library preparation using the Illumina stranded mRNA-Kit (Illumina, San Diego, USA) quantified and qualified (DNA High Sensitivity assay ...
-
bioRxiv - Cell Biology 2024Quote: ... We prepared sequencing libraries at the Next Generation Sequencing (NGS) platform at Institut Curie (Illumina TruSeq ChIP kit) and performed PE100 sequencing on Illumina NovaSeq 6000 ...
-
bioRxiv - Microbiology 2024Quote: ... The libraries were prepared with Nextera® XT index Kit v2 Set A (Illumina, San Diego, CA, USA). Once prepared ...
-
bioRxiv - Molecular Biology 2024Quote: ... or on a NextSeq 2000 using a NextSeq 1000/2000 P2 Reagents 100 cycle kit (Illumina cat #20046811). Barcodes were read twice by the paired-end sequencing primers JJS25 and JJS26 ...
-
bioRxiv - Biochemistry 2024Quote: ... Double stranded cDNA was then prepared for the libraries using an Illumina Stranded mRNA Prep Ligation kit (Illumina). Ampure XP beads (Beckman Coulter ...
-
Leveraging single cell multiomic analyses to identify factors that drive human chondrocyte cell fatebioRxiv - Developmental Biology 2024Quote: ... RNA sequencing libraries were prepared using the NEBNext Ultra II RNA Library Prep kit (Azenta) and sequenced (Illumina) to a minimum of 30,000 reads per sample using 2 x 150bp paired-end reads.
-
bioRxiv - Bioengineering 2024Quote: ... and loaded on an Illumina MiSeqDx using a MiSeq Reagent Nano Kit v2 (Illumina, Cat# MS-101-1001) according to the manufacturer’s protocol ...
-
bioRxiv - Biochemistry 2024Quote: ... All samples were prepared for sequencing with the Illumina TruSeq DNA PCR-Free Library Preparation Kit (Illumina, USA) and sequencing on an Illumina HiSeq Sequencer (paired-end 150 bp).19
-
bioRxiv - Cancer Biology 2024Quote: ... libraries were constructed using 600 ng of total RNA per sample with the TruSeq Stranded mRNA kit (Illumina), following the manufacturer’s guidelines ...
-
bioRxiv - Microbiology 2024Quote: ... and paired-end sequencing (300 bp × 2) on the MiSeq platform with the MiSeq Reagent Kit v3 (Illumina) were conducted as described previously [31] ...
-
ATP-dependent citrate lyase Drives Left Ventricular Dysfunction by Metabolic Remodeling of the HeartbioRxiv - Molecular Biology 2024Quote: ... using a HiSeq 3000/4000 SBS 300-cycle kit (Cat#FC-410-1003, Illumina, Inc., San Diego, CA) for 2×150 paired-end reads ...
-
bioRxiv - Molecular Biology 2024Quote: ... using a paired-end read length of 2 × 150bp with the HiSeq Reagent Kits (Illumina, San Diego, California) (Cogne et al ...
-
bioRxiv - Microbiology 2024Quote: ... RNA-seq transcriptome libraries were prepared following the TruSeqTM RNA sample preparation Kit from Illumina (San Diego, CA), using 1μg of total RNA ...
-
bioRxiv - Microbiology 2024Quote: ... Short-read sequencing libraries were prepared using an Illumina DNA PCR-Free Prep kit (Illumina, San Diego, CA). The libraries were sequenced on a NovaSeq 6000 platform (Illumina) ...
-
bioRxiv - Synthetic Biology 2024Quote: ... The whole plasmid sequences were verified using Nextera XT DNA library prep kit (Illumina, Catalog #FC-131-1096) or whole plasmid sequencing services provided by Plasmidsaurus Inc ...
-
bioRxiv - Microbiology 2020Quote: ... Metagenomic shotgun libraries were prepared using the Nextera XT DNA Sample Preparation Kit (Illumina Inc., San Diego, CA, USA) and subject to paired-end sequencing (2 × 150 bp ...
-
bioRxiv - Plant Biology 2020Quote: ... Libraries for RNA-seq were prepared by using the Illumina TruSeq RNA library Prep Kit (RS-122-2001, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: Small RNA size selection and library preparation using the TruSeq Small RNA Library Prep Kit (RS- 200-0012, Illumina) were performed following the detailed protocol previously published (Mathioni et al. ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was depleted from ribosomal RNA using the Ribo-Zero Depletion Kit for Gram-negative bacteria (Illumina, USA). Libraries were prepared using a TruSeq Stranded Total RNA library preparation kit (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR amplification and DNA library preparation were done using Nextera DNA library prep kit according to the manufacturer’s instructions (Illumina). DNA was purified and eluted using MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... These pools were prepared for metatranscriptomic sequencing using the Illumina compatible Nextera XT library preparation kit (Illumina, California, U.S.) and sequenced on an Illumina MiSeq using v3 chemistry (Illumina).
-
bioRxiv - Immunology 2021Quote: ... Sequence-ready libraries were prepared using the Illumina TruSeq Total Transcriptome kit with Ribo-Zero Gold rRNA depletion (Illumina). Quality assessment and quantification of RNA preparations and libraries were carried out using an Agilent 4200 TapeStation and Qubit 3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Poly(A) selected pair-end sequencing libraries were generated using the Illumina TrueSeq Stranded mRNA Sample Prep Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2019Quote: ... The sequencing libraries were quantified by quantitative PCR (KAPA Biosystems Library Quantification Kit for Illumina platforms P/N KK4824) and Qubit 3.0 with dsDNA HS Assay Kit (Thermo Fisher Scientific) ...
-
bioRxiv - Cell Biology 2020Quote: ... Illumina pair-end sequencing was performed on a NextSeq 550 instrument using a sequencing chip of 300 Mid Output Kit v2.5 (120 million reads, cat 20024905, Illumina). The read length was 200 bp and 7 bp for the indexing primers ...
-
bioRxiv - Immunology 2021Quote: ... were performed prior to cDNA library preparation using the Illumina TruSeq Stranded mRNA sample preparation kit (Illumina, CA, USA). Globin transcript depletion ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were extracted by resuspending the samples in 50 μl transposition reaction Tn5 mix (Illumina Nextera DNA Library Kit) (FC121-1030 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and libraries were prepared with the Illumina TruSeq Nano HT DNA Library Preparation Kit (Illumina, San Diego, California, USA) or the KAPA Hyper Prep DNA Library Kit (KAPA ...