Labshake search
Citations for Illumina :
5601 - 5650 of 9193 citations for Mouse CXCL2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2023Quote: Total RNA was used for removal of ribosomal RNA (rRNA) using Ribo-Zero rRNA Removal Kits (Illumina, USA) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2022Quote: ... Libraries for RNA-seq were prepared using the Illumina TruSeq RNA library Prep Kit (RS-122-2001, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2023Quote: ... and 1ug of total RNA was used to prepare RNA-seq libraries with TruSeq Stranded mRNA kit (Illumina), and the libraries were sequenced on Illumina NovaSeq 6000 instruments.
-
bioRxiv - Genetics 2022Quote: ... Sequencing was performed using NextSeq 500/550 High-Output v2.5 (150 cycle) kit on NextSeq 550 platform (Illumina). Libraries were combined into a single equimolar pool of 12 ...
-
bioRxiv - Neuroscience 2023Quote: ... Sequencing libraries were prepared from 500 pg of cDNA with a Nextera XT DNA Library Prep kit (Illumina). Libraries were paired-end sequenced at 75×75 bases on a NextSeq 500 system (Illumina) ...
-
bioRxiv - Neuroscience 2022Quote: RNA sequencing of hippocampal tissue was carried out using TruSeq Stranded Total RNA kit and protocols (Illumina, US). A 1ug aliquot of total RNA from each hippocampus was prepared for RNA sequencing ...
-
bioRxiv - Physiology 2022Quote: ... Sequencing libraries were generated from 0.5 µg of total RNA using TruSeq Stranded Total RNA preparation kit (Illumina) as per manufacturer’s instructions ...
-
bioRxiv - Synthetic Biology 2022Quote: ... and a unique combination of the dual-barcoded primers P5 and P7 Nextera XT Index kit (Illumina #15055293). The cycling conditions were ...
-
bioRxiv - Molecular Biology 2022Quote: Small RNA libraries were made using the Illumina TruSeq Kit following the manufacturer’s protocol (Illumina, San Diego, CA). Briefly ...
-
bioRxiv - Molecular Biology 2022Quote: ... ChIP-seq libraries were prepared by the Montpellier MGX platform (https://www.mgx.cnrs.fr) using TruSeq®ChIP Sample Preparation kits (Illumina). The sequencing was processed on Hi-SEQ 2000 (Illumina ...
-
bioRxiv - Neuroscience 2022Quote: ... Gene expression and barcode libraries were prepared in parallel using the Chromium Next GEM Single Cell 3’ Kit v3.1 (10x Genomics) according to manufacturer’s instructions and sequenced in a Novaseq 6000 system (Illumina). A detailed step-by-step protocol can be found on protocols.io ...
-
bioRxiv - Molecular Biology 2022Quote: ... Sequencing libraries were constructed from 100 ng total RNA using a Truseq stranded mRNA Library Prep Kit (Illumina) without the poly-A selection step ...
-
bioRxiv - Molecular Biology 2022Quote: ... RNA sequencing was performed on an Illumina NextSeq500 platform (SBS50 kit, high-output mode, Illumina, San Diego, CA) using default parameters for paired-end sequencing (76bp + 9bp) ...
-
bioRxiv - Microbiology 2022Quote: ... Whole genome metagenomic libraries were prepared at LLNL using the Illumina DNA Flex library kit (now called Illumina DNA Prep ...
-
bioRxiv - Microbiology 2022Quote: ... The cleaned pool was sequenced on the Illumina MiSeq using v.2 2_250 base-pair kit (Illumina, Inc). Two PCR controls were also sequenced to test for PCR reagent contamination.
-
bioRxiv - Molecular Biology 2022Quote: ... 1ug of input RNA was subjected to rRNA depletion with the Ribo-Zero Glod Yeast kit (MRZY1324, Illumina) following manufacturer instructions.
-
bioRxiv - Immunology 2022Quote: ... Thermo) and a sequencing library was constructed using the Illumina TruSeq RNA Library Prep for Enrichment kit (Illumina). The sequencing library was enriched for SARS-CoV-2 using the Twist Respiratory Virus Research Panel (Twist) ...
-
bioRxiv - Plant Biology 2022Quote: ... RNA-seq libraries of polyA+-selected samples were prepared using TruSeq Stranded mRNA Library Preparation Kit LT (Illumina). After quality control ...
-
bioRxiv - Immunology 2022Quote: ... libraries were sequenced by Novaseq 6000 platform running Novaseq 6000 S4 Reagent Kit v1.5 300 cycles (Illumina, 20028312) or NovaSeq XP 4-Lane Kit v1.5 (Illumina ...
-
bioRxiv - Genomics 2022Quote: ... Enrichment of DNA fragments was performed as described for Illumina TruSeq Nano DNA LT Kit (Illumina, Cat#: 20015964). Sample clean up was performed with Agencourt AMPure XP beads (Beckman Coulter ...
-
bioRxiv - Microbiology 2022Quote: Library preparation was performed using the tagmentation based Illumina DNAFlex Library Prep kit (Illumina, San Diego, CA, USA), according to the manufacturer’s protocol ...
-
bioRxiv - Neuroscience 2022Quote: ... Libraries were quantified using the Universal Library Quantification Kit (KAPA) before sequencing on a NextSeq 550 system (Illumina) at the Institute for Research in Immunology and Cancer (IRIC ...
-
bioRxiv - Microbiology 2024Quote: ... cDNA libraries were prepared using the TrueSeq Stranded Total RNA Sample Preparation kit with Ribo-Zero Plus (Illumina) according to the manufacturer’s protocol and sequenced thereafter via paired-end with the NovaSeq 6000 platform (Illumina) ...
-
bioRxiv - Plant Biology 2024Quote: ... A cDNA library was prepared from each RNA sample using the Illumina TruSeq RNA library preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Plant Biology 2024Quote: ... prior to generating individual indexed libraries each from 1 μg RNA using the Stranded mRNA Prep kit (Illumina), as recommended ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA library of the collected RNA samples was obtained using the TruSeq RNA Library Prep kit from Illumina. Single-end RNA Sequencing was performed on an Illumina HiSeq 2500 Next Generation Sequencing instrument ...
-
bioRxiv - Genomics 2024Quote: ... and sequenced on a NextSeq 550 using a NextSeq 500/550 High Output v2.5 75 cycle kit (Illumina) using custom sequencing primers NP0494-NP0497 ...
-
bioRxiv - Pathology 2024Quote: ... RNA-seq transcriptome libraries were prepared following the NEB Next Ultra RNA Library Prep Kit from Illumina (NEB). NEB Next Poly(A ...
-
bioRxiv - Microbiology 2024Quote: ... All RNA-seq libraries (strand-specific, paired end) were prepared with the TruSeq RNA sample prep kit (Illumina). One hundred nucleotides of sequence were determined from both ends of each cDNA fragment using the Novaseq platform (Illumina) ...
-
bioRxiv - Genetics 2024Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Cell Biology 2023Quote: ... The nuclear pellet was resuspended in transposition reaction mix using the Tagment DNA Enzyme and Buffer Kit (Illumina) as per manufacturer protocol ...
-
bioRxiv - Pharmacology and Toxicology 2023Quote: ... Then the libraries were constructed using TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions and sequenced on an Illumina HiSeq X Ten platform and 150 bp paired-end reads were generated ...
-
bioRxiv - Physiology 2024Quote: ... Ribosomal RNA was removed from samples using the Ribo-Zero rRNA removal kit (Illumina, San Diego, CA, USA). Sequencing libraries were prepared using the TruSeq RNA Library Preparation Kit v2 (Illumina ...
-
bioRxiv - Microbiology 2024Quote: ... The libraries were then subjected to paired end sequencing on Illumina Nextseq using Nextseq Mid Output kit (Illumina) with a read length of 150 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... 3 μg of total RNA samples underwent treatment with the epicenter Ribo-ZeroTM Kit (Illumina, San Diego, USA) to remove rRNA ...
-
bioRxiv - Microbiology 2024Quote: ... DNA for Illumina sequencing was prepared using the Nextera XT DNA library prep kit (Illumina FC-131-1096) with the Nextera XT v2 Index Kit B (Illumina FC-131-2002 ...
-
bioRxiv - Molecular Biology 2024Quote: ... followed by ChIP-seq library preparation using ThruPLEX kit (Rubicon, R400427) and sequenced using NextSeq 500 instrument (Illumina) to produce 75-bp single-end reads.
-
bioRxiv - Molecular Biology 2024Quote: ... Library of polyA-containing mRNA (350 bp size) was prepared using TruSeq Stranded mRNA Library Prep kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2024Quote: Pools were again quantified and sequenced on the Illumina NextSeq500 using NextSeq500/550High Output Kit v2.5 (Illumina, 20024907). The sequencing protocol included 26 cycles for read 1 ...
-
bioRxiv - Neuroscience 2024Quote: ... cDNA libraries were made using the Illumina Stranded Total RNA Prep with Ribo-Zero Plus kit (Illumina, #20040525). Paired end sequencing was carried out on an Illumina NovaSeq (S4 ...
-
bioRxiv - Microbiology 2024Quote: ... Paired-end reads of 301 bp were generated using the MiSeq Reagent Kit v3 chemistry (600-cycle, Illumina).
-
bioRxiv - Cancer Biology 2023Quote: ... RNA libraries were generated from 150 ng of RNA using Illumina’s TruSeq Stranded mRNA Sample Prep Kit (Illumina). Libraries were pooled and single end sequenced (1×75 ...
-
bioRxiv - Cancer Biology 2024Quote: ... 2 µg of total RNA were depleted for ribosomal RNA using a Ribo-Zero-rRNA removal kit (Illumina), followed by random primed cDNA synthesis ...
-
bioRxiv - Neuroscience 2023Quote: ... and sequencing libraries were prepared using Illumina TruSeq Stranded Total RNA Library Prep Ribo-Zero Gold kit (Illumina). Transcriptomic analyses on bulk tissues were performed as previously described 52 ...
-
bioRxiv - Physiology 2023Quote: ... RNA-seq libraries were prepared from 500ng of RNA using TruSeq stranded total RNA library preparation kit (Illumina) and barcoded libraries were combined and submitted for sequencing (paired-end 50 cycles on a HiSeq6000 ...
-
bioRxiv - Microbiology 2024Quote: ... and library preparation was performed with the Stranded Total RNA Prep Ligation with Ribo-Zero Plus Kit (Illumina). Libraries were sequenced with 2×50 bp reads on a NextSeq2000 (Illumina) ...
-
bioRxiv - Molecular Biology 2023Quote: ... Ligation kit (Reference Guide - PN 1000000124518) and IDT for Illumina RNA UD Indexes Ligation (Illumina, San Diego, USA). Briefly ...
-
bioRxiv - Cancer Biology 2023Quote: ... Libraries were quantitated with qPCR (NEBNext Library Quant Kit for Illumina, Bio-rad CFX96 Touch Real-Time PCR). Libraries were normalized to 1.5 pM and pooled ...
-
bioRxiv - Neuroscience 2023Quote: ... 1 ng of amplified RNA was used to prepare cDNA libraries (Nextera XT DNA library preparation kit; Illumina). cDNA libraries for 4 biological replicates for both control (THD’GAL4/+ ...
-
bioRxiv - Cancer Biology 2024Quote: ... Barcoded libraries for each section were generated using the Nextera XT DNA Kit (Illumina Inc., San Diego, CA). After library preparation the barcoded libraries were pooled using bead-based normalization supplied with the Nextera XT kit ...