Labshake search
Citations for Illumina :
5601 - 5650 of 9406 citations for 2'3' cyclic GAMP cGAMP ELISA Kit 5 Strip Plate since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Genetics 2021Quote: ... 1 µg of high quality total RNA sample (RIN >8) was processed using TruSeq Stranded mRNA kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Sample preparation was performed by MSU RTSF with standard protocols of the mRNA-Seq Sample Preparation Kit (Illumina). Sequencing was performed on an Illumina Genome Analyzer II (Illumina) ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... Sequencing libraries for the new samples were prepared with a TruSeq DNA PCR-Free kit (Illumina, CA, USA) with a targeted insert size of 670 bp or with a Truseq DNA nano (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... DNA sequencing libraries were prepared using dual-index adapters with the TruSeq Nano DNA Library Prep kit (Illumina) as per the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2019Quote: ... and cDNA libraries were generated using the TruSeq total stranded RNA-seq kit (Illumina, San Diego, CA, USA). cDNA libraries were sequenced using Illumina HiSeq 2×150bp configuration with estimated data output ≥350M raw paired-end reads per lane ...
-
bioRxiv - Immunology 2021Quote: ... Libraries from PBMC RNA were generated using the TruSeq Stranded RNA LT kit (Illumina, San Diego, CA, USA). Libraries from purified CD14+ monocytes RNA were generated using the NEBnext Ultra II Directional RNA Library Prep Kit for Illumina (NEB ...
-
bioRxiv - Genomics 2021Quote: ... 1000 ng of total RNA was used as input for the TruSeq Small RNA Library preparation kit (Illumina) following manufacturer’s protocol ...
-
bioRxiv - Genomics 2021Quote: ... according to manufacturer”s instructions and sequenced using a 2 × 250-cycle MiSeq Reagent kit v3.0 (Illumina, CA).
-
bioRxiv - Genomics 2020Quote: ... RNA-seq libraries were prepared from two biological replicates using the True-Seq stranded total RNA kit (Illumina) and sequenced paired-end in a pool of 12 indexed libraries using a Next-Seq 500/550 high output kit v2 150 cycles (Illumina ...
-
bioRxiv - Genomics 2021Quote: ... The mRNA library was then constructed using the TruSeq RNA sample preparation V2 kit (Illumina, San Diego, USA) starting from RNA fragmentation ...
-
bioRxiv - Genomics 2020Quote: ... The short-read genome library was prepared with the Nextera Flex DNA library preparation kit (Illumina, San Diego) and sequenced on the MiSeq with 2 x 300bp V3 chemistry ...
-
bioRxiv - Genomics 2020Quote: ... Strand-specific mRNA sequencing was performed from total RNA using TruSeq Stranded mRNA Sample Prep Kit LT (Illumina) according to manufacturer’s instructions ...
-
bioRxiv - Immunology 2021Quote: ... The pooled library sample plus PhiX was sequenced using the MiSeq Reagent Kit v3 (Illumina, #MS-102-3003) on the Illumina MiSeq system.
-
bioRxiv - Immunology 2021Quote: ... The library for mRNA sequencing was generated using the TruSeq Stranded Total RNA LT Sample Prep Kit (Illumina) and sequencing was performed with NovaSeq 6000 (Illumina) ...
-
bioRxiv - Microbiology 2021Quote: ... DNA precipitations were completed with a MasterPure Gram Positive DNA Purification kit (Epicentre, Illumina, Cat # MGP04100, Madison, Wisconsin) according to its instruction manual.
-
bioRxiv - Microbiology 2021Quote: ... Ribosomal RNA removal was performed using 9µL of the DNA-free RNA using the RiboZero Plus kit (Illumina) according to the manufacturer’s protocol) ...
-
bioRxiv - Developmental Biology 2021Quote: ... Next Generation Sequencing was performed on a NextSeq500 platform using a NextSeqTM500 150-cycle High Output Kit) (Illumina) to generate 80-basepair paired end reads.
-
bioRxiv - Neuroscience 2020Quote: Cluster generation was performed according to the TruSeq SR Rapid Cluster kit v2 (cBot) Reagents Preparation Guide (Illumina). Briefly ...
-
bioRxiv - Cell Biology 2021Quote: ... was used to analyze total RNA and ribosomal RNA was removed per the Ribo-Zero Gold Kit (Illumina). The remaining RNA fragments were used to construct a strand-specific cDNA library using the dUTP method (average library insert size was 300 ± 50 bp ...
-
bioRxiv - Microbiology 2020Quote: ... Strand-specific mRNA sequencing was performed from total RNA using TruSeq Stranded mRNA Sample Prep Kit LT (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Biochemistry 2020Quote: Ribosome profiling (McGlincy & Ingolia, 2017) was performed using the TruSeq Ribo Profile (Yeast) kit (Illumina, San Diego, USA). A BY4741 HIS3 strain (Costello et al. ...
-
bioRxiv - Neuroscience 2020Quote: ... single-end sequencing was performed on an Illumina NovaSeq6000 sequencer using an S1 100 cycle kit (Illumina Inc.), with all libraries run on a single lane to return an average depth of 37 million reads per library ...
-
bioRxiv - Cell Biology 2021Quote: ... cDNA was tagmented in 10 technical replicates of 1 ng cDNA each using the Nextera XT Kit (Illumina), according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2021Quote: ... RNA sequencing libraries were prepared using the Illumina TruSeq RNA Sample Prep kit v2 (Illumina, RS-122-2001) and sequenced using the Illumina HiSeq2500 platform ...
-
bioRxiv - Plant Biology 2021Quote: ... RNA-seq libraries were prepared using an Illumina TruSeq Stranded mRNA Library Prep kit (catalog number 20020594; Illumina) following the manufacture’s protocol ...
-
bioRxiv - Biochemistry 2020Quote: ... Germany) using the TrueQuant smallRNA Seq kit according manufacturer’s instructions and were sequenced on a HiSeq2000 (Illumina, USA). After quality control filtering and adapter trimming using Cutadapt31 ...
-
bioRxiv - Plant Biology 2021Quote: ... a barcoded genomic library was constructed using the TruSeq DNA library preparation kit (Illumina, San Diego, CA, USA). Standard indexing adapters were ligated to the fragment ends to generate single-index libraries ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA-seq libraries were prepared with a TruSeq Stranded mRNAseq Sample Prep kit (Illumina, San Diego, CA, USA) at the Roy J ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic cDNA libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit (Illumina, San Diego, CA) with Ribo-Zero to deplete ribosomal RNA (rRNA) ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA library was prepared using the TruSeq RNA Sample Preparation kit v2 (Illumina, San Diego, CA, USA) and paired-end (150 bp ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-seq libraries of cDNA were generated using ScriptSeq™ Complete v2 RNA-seq Library Preparation Kit (Illumina) and purified using Monarch DNA cleanup kit (New England Biolabs) ...
-
bioRxiv - Systems Biology 2020Quote: ... and libraries were prepared from 200 ng of total RNA using TruSeq Stranded mRNA library preparation kit (Illumina). The resulting libraries were assessed by TapeStation D1K TapeScreen assay (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Plant Biology 2021Quote: ... RNAseq libraries were constructed using Illumina TruSeq Stranded mRNA Sample Preparation Kit (Illumina Inc., San Diego, CA, USA) according to the protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were constructed using the TruSeq Stranded mRNA Sample preparation kit (20020595) following the manufacturer’s instructions (Illumina). The directional libraries were controlled on Bioanalyzer DNA1000 Chips (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... using paired-end (PE) read libraries (PE250) made with an Illumina Nextera XT DNA Library Prep Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted DNA was amplified by PCR using NGS primers supplied with the kit (NEBNext Multiplex Oligos for Illumina, Index Primers Set 1 and 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Extracted RNA from nasopharyngeal swabs was first depleted of ribosomal RNA using RiboZero rRNA removal Kit (Illumina, USA). The residual RNA was then converted to double stranded cDNA using random priming ...
-
bioRxiv - Microbiology 2021Quote: ... and then sequenced on an Illumina MiSeq® benchtop sequencer with MiSeq reagent kit v3 (Illumina Inc., USA), resulting in 300 bp paired-end reads ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were generated from 1 ng genomic DNA by using the Nextera XT DNA Library Prep Kit (Illumina). Sequencing was performed using a MiSeq Reagent Kit v3 cartridge (600-cycle kit ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were prepared from pools of 12 individuals using the TruSeq Stranded mRNA library preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The pair-end sequencing library was prepared using the TruSeq DNA PCR-Free Prep Kit (Illumina, United States). The prepared library was sequenced on the NovaSeq 6000 platform (2 × 150 bp chemistry ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing was performed on an Illumina MiSeq using the MiSeq Reagent Kit v3 (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... ribosomal RNA was depleted using the Ribo-Zero rRNA Removal kit for bacterial rRNA (Illumina, San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was constructed according to the manufacturer’s protocol of the Truseq Stranded mRNA Sample Prep LS Kit (Illumina). The 16 first-strand paired-end (2×100 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and genome-wide DNA methylation was assessed by the Infinium MethylationEPIC kit according to the manufacturer’s protocol (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sequencing library was prepared following the standard protocol for TruSeq Stranded Total RNA Sample Prep Kit (Illumina), and paired-ended [2×150 bp] sequencing was performed on NovaSeq 6000 sequencing system (Illumina) ...