Labshake search
Citations for Illumina :
5501 - 5550 of 8781 citations for Parallel Artificial Membrane Permeability Assay PAMPA Kit since 2020
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Neuroscience 2024Quote: ... 150 pg cDNA was used to generate Illumina compatible sequencing libraries with the NexteraXT library preparation kit (Illumina) per manufacturer’s protocols ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... Each sWGA library was prepared using the two pooled amplification products and the Nextera XT DNA kit (Illumina), following the manufacturer’s protocol ...
-
bioRxiv - Systems Biology 2024Quote: ... Samples were then indexed using the Nextera XT Index Kit v2 (dual indexes and Illumina sequencing adaptors added), cleaned ...
-
bioRxiv - Immunology 2024Quote: ... and sequenced as 2 × 75 base reads on the NextSeq instrument using three high output chemistry kits (Illumina). Raw fastq reads were trimmed of Illumina adapter sequences using cutadapt (version 1.12) ...
-
bioRxiv - Immunology 2024Quote: ... 100pg of amplified cDNA obtained was used to generate a library using Nextera XT DNA preparation kit (Illumina). The quality of cDNA and library products was checked and quantified using an Agilent High Sensitivity DNA chip ...
-
bioRxiv - Immunology 2024Quote: ... Approximately 800 pg of purified amplified cDNA was tagmented using the Nextera XT DNA Sample Preparation kit (Illumina) and amplified for 12 cycles using the SI-PCR forward primer (10x Genomics ...
-
bioRxiv - Immunology 2024Quote: ... Nuclei pellet was resuspended into transposition reaction mixture containing Tn5 transposase from Nextera DNA Sample Prep Kit (Illumina) and incubated for 30 min with gentle shaking at 37°C ...
-
bioRxiv - Immunology 2024Quote: ... Subsequently 30ul of cDNA was used as a starting material with Illumina DNA Prep library kit (Illumina, 20018705) according to the vendor protocol ...
-
bioRxiv - Genomics 2024Quote: ... the Oxford Nanopore GridION using R9.4.1 flow cells and the Illumina MiSeq using 500 cycle v2 kit (Illumina). Quality control ...
-
bioRxiv - Genomics 2024Quote: An Illumina short-read library was prepared with a TruSeq DNA PCR-Free Library Prep Kit (Illumina, US). Two runs of 150 bp paired-end sequencing was then performed on a NovaSeq 6000 (Illumina ...
-
Transcriptional dynamics of sleep deprivation and subsequent recovery sleep in the male mouse cortexbioRxiv - Neuroscience 2024Quote: ... the flow cell was loaded onto the HiSeq 2500 for sequencing using the HiSeq SBS kit v4 (Illumina). DNA was paired-end sequenced with a read length of 100 bp and an average sequencing depth of 54 million read pairs per sample ...
-
bioRxiv - Immunology 2024Quote: ... 150 picograms of cDNA were used to make sequencing libraries by Nextera XT DNA Sample Preparation Kit (Illumina). Libraries were quantified with Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific ...
-
bioRxiv - Animal Behavior and Cognition 2024Quote: ... ds-cDNA was prepared according to manufacturer protocol (SMARTer Ultra Low RNA kit for Illumina Sequencing, Takara-Clontech). cDNA was fragmented ...
-
bioRxiv - Genetics 2024Quote: ... libraries were sequenced on an Illumina NextSeq 500 instrument using the 75-cycle High Output v2 Kit (Illumina). We loaded the library at 2.0 pM and provided Custom Read1 Primer (GCCTGTCCGCGGAAGCAGTGGTATCAACGCAGAGTAC ...
-
bioRxiv - Genetics 2024Quote: ChIP sequencing libraries were prepared at the YCGA with a TruSeq Library Prep Kit (Illumina, San Diego, CA). They were validated using an Agilent Bioanalyzer 2100 High sensitivity DNA assay ...
-
bioRxiv - Bioengineering 2024Quote: ... 200 ng of high quality total RNA sample (RIN >8.2) was processed using Stranded mRNA Prep kit (Illumina) according to manufacturer instructions ...
-
bioRxiv - Cell Biology 2024Quote: ... RNA sequencing was carried out on Illumina NextSeq 500 using the High Output Kit v2.5 (150 cycles, Illumina) for 2 × 75 bp paired-end reads.
-
bioRxiv - Cell Biology 2024Quote: ... (Spike in) CUT & RUN seq libraries were prepared using NEBNext® Ultra™ II DNA library kit (Illumina). Samples were pooled and paired end sequencing (25 bp ...
-
bioRxiv - Cell Biology 2024Quote: ... DNA sequencing was carried out on Illumina NextSeq 500 using the High Output Kit v2.5 (150 cycles, Illumina) for 2 × 75 bp paired-end reads.
-
bioRxiv - Cell Biology 2024Quote: ... Strand-specific libraries were generated using the TruSeq Stranded mRNA samples preparation kit (Illumina Inc., San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... WGS libraries were prepared for each sample using an Illumina TruSeq DNA Library Preparation Kit (Illumina, CA, USA) and sequenced on three lanes of an Illumina HiSeq2500 (2×150bp ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... PolyA+ libraries of the large-scale dataset were prepared with the Truseq V2 kit (Illumina, non stranded protocol), starting with 150 ng total RNA ...
-
bioRxiv - Evolutionary Biology 2024Quote: ... and prepared 32 individuals for WGS sequencing with the Illumina DNA Prep kit (Illumina, Inc. San Diego, CA). Sequences were generated on the Element Bio AVITI instrument at UC Davis with a paired-end 2x150 protocol ...
-
bioRxiv - Developmental Biology 2024Quote: ... mRNA libraries of each sample were prepared using a TruSeq Stranded mRNA library Kit (Illumina, San Diego, CA) according to the manufacturer’s protocol and paired end sequences were read by NovaSeq (Illumina) ...
-
bioRxiv - Microbiology 2020Quote: ... Metagenomic shotgun libraries were prepared using the Nextera XT DNA Sample Preparation Kit (Illumina Inc., San Diego, CA, USA) and subject to paired-end sequencing (2 × 150 bp ...
-
bioRxiv - Plant Biology 2020Quote: ... Libraries for RNA-seq were prepared by using the Illumina TruSeq RNA library Prep Kit (RS-122-2001, Illumina) according to the manufacturer’s protocol ...
-
bioRxiv - Plant Biology 2020Quote: Small RNA size selection and library preparation using the TruSeq Small RNA Library Prep Kit (RS- 200-0012, Illumina) were performed following the detailed protocol previously published (Mathioni et al. ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... Total RNA was depleted from ribosomal RNA using the Ribo-Zero Depletion Kit for Gram-negative bacteria (Illumina, USA). Libraries were prepared using a TruSeq Stranded Total RNA library preparation kit (Illumina ...
-
bioRxiv - Neuroscience 2021Quote: ... PCR amplification and DNA library preparation were done using Nextera DNA library prep kit according to the manufacturer’s instructions (Illumina). DNA was purified and eluted using MinElute PCR purification kit (Qiagen) ...
-
bioRxiv - Molecular Biology 2020Quote: ... These pools were prepared for metatranscriptomic sequencing using the Illumina compatible Nextera XT library preparation kit (Illumina, California, U.S.) and sequenced on an Illumina MiSeq using v3 chemistry (Illumina).
-
bioRxiv - Immunology 2021Quote: ... Sequence-ready libraries were prepared using the Illumina TruSeq Total Transcriptome kit with Ribo-Zero Gold rRNA depletion (Illumina). Quality assessment and quantification of RNA preparations and libraries were carried out using an Agilent 4200 TapeStation and Qubit 3 ...
-
bioRxiv - Cell Biology 2020Quote: ... Poly(A) selected pair-end sequencing libraries were generated using the Illumina TrueSeq Stranded mRNA Sample Prep Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Cell Biology 2020Quote: ... Illumina pair-end sequencing was performed on a NextSeq 550 instrument using a sequencing chip of 300 Mid Output Kit v2.5 (120 million reads, cat 20024905, Illumina). The read length was 200 bp and 7 bp for the indexing primers ...
-
bioRxiv - Immunology 2021Quote: ... were performed prior to cDNA library preparation using the Illumina TruSeq Stranded mRNA sample preparation kit (Illumina, CA, USA). Globin transcript depletion ...
-
bioRxiv - Immunology 2021Quote: ... Nuclei were extracted by resuspending the samples in 50 μl transposition reaction Tn5 mix (Illumina Nextera DNA Library Kit) (FC121-1030 ...
-
bioRxiv - Evolutionary Biology 2020Quote: ... and libraries were prepared with the Illumina TruSeq Nano HT DNA Library Preparation Kit (Illumina, San Diego, California, USA) or the KAPA Hyper Prep DNA Library Kit (KAPA ...
-
bioRxiv - Genetics 2021Quote: ... 2.5 µg of total RNA was subjected to ribosomal RNA (rRNA) depletion using the Illumina’s Ribo-zero Gold kit (Illumina), according to the manufacturer’s protocol ...
-
bioRxiv - Genetics 2021Quote: ... Sequencing libraries for whole-genome sequencing were prepared from 200-300 ng of DNA using DNA Prep Kit (Illumina), with KAPA HiFi Uracil+ Kit (Roche ...
-
bioRxiv - Genetics 2021Quote: Purified samples were then amplified by PCR (maximum 12 cycles) using barcoded primers from the Nextera Index Kit (Illumina). To determine the optimal number of cycles for each sample ...
-
bioRxiv - Genetics 2021Quote: ... Sequencing was done using Illumina NextSeq 500 and NextSeq 500/550 High Output Kit v2.5 (75 Cycles) (Illumina, 20024906). Raw reads were analysed by BlueBee Platform (LEXOGEN) ...
-
bioRxiv - Genomics 2021Quote: ... Libraries were generated from 2-5 μg of genomic DNA using the TruSeq 2 library preparation kit (Illumina, USA). Two types of libraries were prepared ...
-
bioRxiv - Microbiology 2021Quote: rRNA were depleted from 0.5 µg of total RNA using the Ribo-Zero rRNA Removal Kit (Bacteria) from Illumina. Sequencing libraries were constructed using the TruSeq Stranded mRNA Sample preparation kit (20020595 ...
-
bioRxiv - Immunology 2021Quote: ... To generate final libraries 200 μg of cDNA was used as input for the NexteraXT DNA Library kit (Illumina) using 10 additional cycles of PCR ...
-
bioRxiv - Neuroscience 2020Quote: ... and libraries were prepared using the NEBNext Ultra II DNA Library Prep Kit from Illumina (New England Biolabs #37645) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... cDNA library construction using TruSeq Stranded Total RNA Library Prep Kit with Ribo-Zero Human (Illumina #RS-122-2201) and sequencing on an Illumina NovaSeq6000 platform was performed by Macrogen (Tokyo ...
-
bioRxiv - Developmental Biology 2021Quote: ... Sequencing libraries were prepared from 1 μg total RNA using the TruSeq Standard mRNA LT Sample Preparation Kit (Illumina) and sequenced by Illumina NextSeq500 (Illumina ...
-
bioRxiv - Developmental Biology 2021Quote: The libraries were prepared for 150bp paired-end sequencing using TruSeq stranded mRNA Sample Preparation Kit (Illumina, CA, USA). Namely ...
-
bioRxiv - Microbiology 2021Quote: ... DNA libraries were generated using the 24 extracted DNA with the Nextera XT DNA library preparation kit (Illumina Inc.) according to the manufacturer’s instructions ...
-
bioRxiv - Cancer Biology 2021Quote: ... and 1.3 pM of the multiplexed pool was sequenced on a NextSeq 500 instrument with NextSeq 500/550 Mid/high Output v1/v2/v2.5 kits (Illumina) to obtain 75-bp paired-end reads ...
-
bioRxiv - Evolutionary Biology 2021Quote: ... using the Illumina Hiseq 4000 platform after library preparation with the Nextera XT DNA Library Prep kit (Illumina, USA).