Labshake search
Citations for Illumina :
5451 - 5500 of 9266 citations for Human E3 Ubiquitin Protein Ligase SMURF2 SMURF2 ELISA Kit since 2019
Citations are collected from bioRxiv only, the total number of publications could be much larger.
-
bioRxiv - Biochemistry 2020Quote: ... Germany) using the TrueQuant smallRNA Seq kit according manufacturer’s instructions and were sequenced on a HiSeq2000 (Illumina, USA). After quality control filtering and adapter trimming using Cutadapt31 ...
-
bioRxiv - Plant Biology 2021Quote: ... a barcoded genomic library was constructed using the TruSeq DNA library preparation kit (Illumina, San Diego, CA, USA). Standard indexing adapters were ligated to the fragment ends to generate single-index libraries ...
-
bioRxiv - Plant Biology 2020Quote: ... RNA-seq libraries were prepared with a TruSeq Stranded mRNAseq Sample Prep kit (Illumina, San Diego, CA, USA) at the Roy J ...
-
bioRxiv - Microbiology 2020Quote: ... Genomic cDNA libraries were prepared using the TruSeq Stranded Total RNA Library Prep Kit (Illumina, San Diego, CA) with Ribo-Zero to deplete ribosomal RNA (rRNA) ...
-
bioRxiv - Plant Biology 2020Quote: ... The cDNA library was prepared using the TruSeq RNA Sample Preparation kit v2 (Illumina, San Diego, CA, USA) and paired-end (150 bp ...
-
bioRxiv - Microbiology 2020Quote: ... RNA-seq libraries of cDNA were generated using ScriptSeq™ Complete v2 RNA-seq Library Preparation Kit (Illumina) and purified using Monarch DNA cleanup kit (New England Biolabs) ...
-
bioRxiv - Systems Biology 2020Quote: ... and libraries were prepared from 200 ng of total RNA using TruSeq Stranded mRNA library preparation kit (Illumina). The resulting libraries were assessed by TapeStation D1K TapeScreen assay (Agilent ...
-
bioRxiv - Neuroscience 2021Quote: ... Purified amplicons were prepared for sequencing using the Nextera XT DNA Library Preparation Kit (Illumina #FC-131-1001) using 1 ng of purified amplicon library per sample ...
-
bioRxiv - Plant Biology 2021Quote: ... RNAseq libraries were constructed using Illumina TruSeq Stranded mRNA Sample Preparation Kit (Illumina Inc., San Diego, CA, USA) according to the protocol ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing libraries were constructed using the TruSeq Stranded mRNA Sample preparation kit (20020595) following the manufacturer’s instructions (Illumina). The directional libraries were controlled on Bioanalyzer DNA1000 Chips (Agilent Technologies ...
-
bioRxiv - Microbiology 2021Quote: ... using paired-end (PE) read libraries (PE250) made with an Illumina Nextera XT DNA Library Prep Kit (Illumina) according to the manufacturer’s instructions ...
-
bioRxiv - Neuroscience 2020Quote: ... Full-length cDNA was then processed with a Nextera XT DNA Library Preparation Kit (Illumina, FC-131-1096). This kit aims to fragment and add adapter sequences onto template DNA with a single tube Nextera XT tagmentation reaction and so generate multiplex sequencing libraries ...
-
bioRxiv - Microbiology 2021Quote: ... Eluted DNA was amplified by PCR using NGS primers supplied with the kit (NEBNext Multiplex Oligos for Illumina, Index Primers Set 1 and 2 ...
-
bioRxiv - Microbiology 2021Quote: ... Extracted RNA from nasopharyngeal swabs was first depleted of ribosomal RNA using RiboZero rRNA removal Kit (Illumina, USA). The residual RNA was then converted to double stranded cDNA using random priming ...
-
bioRxiv - Microbiology 2021Quote: ... and then sequenced on an Illumina MiSeq® benchtop sequencer with MiSeq reagent kit v3 (Illumina Inc., USA), resulting in 300 bp paired-end reads ...
-
bioRxiv - Microbiology 2021Quote: ... Libraries were generated from 1 ng genomic DNA by using the Nextera XT DNA Library Prep Kit (Illumina). Sequencing was performed using a MiSeq Reagent Kit v3 cartridge (600-cycle kit ...
-
bioRxiv - Microbiology 2021Quote: ... Sequencing libraries were prepared from pools of 12 individuals using the TruSeq Stranded mRNA library preparation kit (Illumina) following the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2020Quote: ... The pair-end sequencing library was prepared using the TruSeq DNA PCR-Free Prep Kit (Illumina, United States). The prepared library was sequenced on the NovaSeq 6000 platform (2 × 150 bp chemistry ...
-
bioRxiv - Microbiology 2020Quote: ... Sequencing was performed on an Illumina MiSeq using the MiSeq Reagent Kit v3 (Illumina, San Diego, CA, USA).
-
bioRxiv - Microbiology 2020Quote: ... ribosomal RNA was depleted using the Ribo-Zero rRNA Removal kit for bacterial rRNA (Illumina, San Diego, CA) according to the manufacturer’s instructions ...
-
bioRxiv - Molecular Biology 2021Quote: ... which was constructed according to the manufacturer’s protocol of the Truseq Stranded mRNA Sample Prep LS Kit (Illumina). The 16 first-strand paired-end (2×100 bp ...
-
bioRxiv - Molecular Biology 2021Quote: ... 4 μg total RNA per sample were used for the TruSeq Stranded mRNA LT Sample Prep Kit (Illumina) to generate cDNA libraries according to the manufacturer’s protocol ...
-
bioRxiv - Cancer Biology 2020Quote: ... and genome-wide DNA methylation was assessed by the Infinium MethylationEPIC kit according to the manufacturer’s protocol (Illumina).
-
bioRxiv - Cancer Biology 2020Quote: ... RNA-sequencing was performed using NextSeq75 High Output v2 kit and NextSeq 500 (Illumina; cat# FC-404-2005). Using TruSeq 3’ SE adaptor sequence AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC ...
-
bioRxiv - Cancer Biology 2020Quote: ... The sequencing library was prepared following the standard protocol for TruSeq Stranded Total RNA Sample Prep Kit (Illumina), and paired-ended [2×150 bp] sequencing was performed on NovaSeq 6000 sequencing system (Illumina) ...
-
bioRxiv - Cancer Biology 2020Quote: ... mRNA libraries for A/E9a;NRASG12D;Ifnar1-/- tumor cells were generated using TruSeq RNA Library Prep kit (Illumina) and sequenced in a HiSeq2500 sequencer PE50bp (Illumina) ...
-
bioRxiv - Cancer Biology 2020Quote: Libraries for RNA sequencing were prepared using the TruSeq Stranded mRNAseq Sample Prep Kit (Illumina, San Diego, CA). The libraries were quantitated by qPCR and sequenced on one lane for 101 cycles from one end of the fragments on a NovaSeq 6000 (Illumina ...
-
bioRxiv - Cell Biology 2021Quote: ... Strand-specific libraries were generated with 500ng of RNA using TruSeq library preparation kit (Illumina, San Diego, CA). The cDNA libraries were multiplexed and sequenced using Illumina NextSeq 500 with single-end 75bp read length parameters ...
-
bioRxiv - Cancer Biology 2020Quote: ... Analysis for hotspot mutations was performed with the TruSight Tumour26 or Tumour97 kit (Illumina, San Diego, CA, USA), which enables the detection of mutations in 26 genes (AKT1 ...
-
bioRxiv - Cancer Biology 2020Quote: Paired-end libraries were constructed by the TruSeq Stranded mRNA library preparation kit v2 (Illumina, San Diego, CA) with a total of 3 μg of RNA per sample ...
-
bioRxiv - Genomics 2022Quote: ... Libraries for Illumina sequencing were constructed using the Illumina Nextera XT kit (Illumina Ltd., San Diego, CA, USA) according to the manufacturer’s recommendations ...
-
bioRxiv - Immunology 2022Quote: ... libraries were sequenced by Novaseq 6000 platform running Novaseq 6000 S4 Reagent Kit v1.5 300 cycles (Illumina, 20028312) or NovaSeq XP 4-Lane Kit v1.5 (Illumina ...
-
bioRxiv - Cell Biology 2022Quote: ... with High output Kit v2.5 (150 cycles) for paired-end sequencing according to standard procedure provided by Illumina.
-
bioRxiv - Immunology 2022Quote: ... libraries were sequenced by Novaseq 6000 platform running Novaseq 6000 S4 Reagent Kit v1.5 300 cycles (Illumina, 20028312) or NovaSeq XP 4-Lane Kit v1.5 (Illumina ...
-
bioRxiv - Evolutionary Biology 2022Quote: ... The extracted DNAs were converted to paired end libraries using Nextera XT DNA Library Prep Kit (Illumina, USA) and the libraries were sequenced with Miseq (Illumina ...
-
bioRxiv - Molecular Biology 2022Quote: ... at least 1.5μg of RNA were depleted of rRNAs using the NEB rRNA-depletion kit (HMR) followed by Illumina library preparation ...
-
bioRxiv - Immunology 2022Quote: ... 500 ng of purified RNA was used as input in the TruSeq Stranded mRNA Library Prep kit (Illumina) according to manufacturer’s specifications ...
-
bioRxiv - Cancer Biology 2022Quote: ... analysis and diluted to 0.1 to 0.2 ng/µl prior to library construction using the Nextera XT sequencing kit (Illumina). Final libraries were pooled and sequenced on an Illumina HiSeq (Northwest Genomics Center ...
-
bioRxiv - Microbiology 2022Quote: ... The final pooled library was sequenced an Illumina MiSeq using a V3 flowcell and 600 cycle kit (Illumina).
-
bioRxiv - Neuroscience 2022Quote: ... and RNA-Seq libraries were obtained using TruSeq RNA Sample Preparation v2 kit (Illumina, Inc., San Diego, USA). To analyze the library quality ...
-
bioRxiv - Immunology 2022Quote: ... spike-in was sequenced using the NextSeq 500 instrument with the NextSeq500/550 High Output v2.5 Kit (Illumina).
-
bioRxiv - Microbiology 2022Quote: ... and a library was then built using a TruSeq RNA Sample Prep Kit (Illumina, San Diego, CA, USA). Furthermore ...
-
bioRxiv - Microbiology 2022Quote: ... The sRNA library was constructed using a TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, CA, USA). Sequencing platforms were selected among Illumina Hiseq2500 platform (MG ...
-
bioRxiv - Molecular Biology 2022Quote: ... Library preparation of high-quality RNA (RIN >8) was performed using the TruSeq RNA sample preparation kit (Illumina). Raw sequencing data was aligned to human genome B38 ...
-
bioRxiv - Microbiology 2022Quote: ... Then the libraries were constructed using TruSeq Stranded mRNA LT Sample Prep Kit (Illumina, San Diego, CA, USA) according to the manufacturer’s instructions ...
-
bioRxiv - Microbiology 2022Quote: ... A second PCR step was performed with Illumina Nextera XT Index Kit v2 (Illumina, Cat.:FC-131-2001) and Ex Taq DNA Polymerase (TaKaRa Bio ...
-
bioRxiv - Genetics 2022Quote: ... and pan-H4ac) was performed on an Illumina NovaSeq 6000 sequencer using a 100-cycle sequencing kit (Illumina). Each library was sequenced to minimum read depth of 80 million reads per input library and 40 million reads per IP library ...
-
bioRxiv - Genetics 2022Quote: ... paired-end sequencing was performed on an Illumina NovaSeq 6000 sequencer using a 100-cycle sequencing kit (Illumina). Each library was sequenced to an average raw depth of 20-25 million reads ...
-
bioRxiv - Immunology 2022Quote: ... RNA sequencing transcriptome library was prepared following TruSeq™ RNA sample preparation Kit from Illumina (San Diego, CA). cDNA was synthesized using a SuperScript double-stranded cDNA synthesis kit (Invitrogen ...
-
bioRxiv - Cancer Biology 2022Quote: ... and 5’-end RNA-seq library preparation using tagmentation-based modified Nextera XT DNA sample Preparation kit (Illumina). Libraries were tagged with a plate-specific i7 index and were pooled by batches of 4-9 plates for sequencing on an Illumina NextSeq550 platform ...